ID: 900298707

View in Genome Browser
Species Human (GRCh38)
Location 1:1965809-1965831
Sequence ATTGGCCACCTCTACTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298707_900298719 25 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298719 1:1965857-1965879 TTGCCCTCCCACGTGGGACAGGG 0: 1
1: 0
2: 0
3: 8
4: 116
900298707_900298716 18 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298716 1:1965850-1965872 GCGGGCATTGCCCTCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
900298707_900298717 19 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298717 1:1965851-1965873 CGGGCATTGCCCTCCCACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 65
900298707_900298713 -1 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298713 1:1965831-1965853 TGCTTACAGAAACCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 39
900298707_900298718 24 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87
900298707_900298709 -8 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 117
900298707_900298712 -4 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298712 1:1965828-1965850 CAATGCTTACAGAAACCGGGCGG 0: 1
1: 0
2: 3
3: 8
4: 60
900298707_900298714 0 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298707_900298710 -7 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298707 Original CRISPR ATTGGCCACCTCTACTGTCA GGG (reversed) Intronic