ID: 900298710

View in Genome Browser
Species Human (GRCh38)
Location 1:1965825-1965847
Sequence GGCCAATGCTTACAGAAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298699_900298710 24 Left 900298699 1:1965778-1965800 CCCCAGAACCAGCAGAACCAGGT 0: 1
1: 0
2: 1
3: 24
4: 251
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298700_900298710 23 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298707_900298710 -7 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298701_900298710 22 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298703_900298710 16 Left 900298703 1:1965786-1965808 CCAGCAGAACCAGGTGGCTTTTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298704_900298710 7 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298708_900298710 -8 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298710 Original CRISPR GGCCAATGCTTACAGAAACC GGG Intronic