ID: 900298711

View in Genome Browser
Species Human (GRCh38)
Location 1:1965827-1965849
Sequence CGCCCGGTTTCTGTAAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298711_900298716 0 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298716 1:1965850-1965872 GCGGGCATTGCCCTCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
900298711_900298718 6 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87
900298711_900298719 7 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298719 1:1965857-1965879 TTGCCCTCCCACGTGGGACAGGG 0: 1
1: 0
2: 0
3: 8
4: 116
900298711_900298717 1 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298717 1:1965851-1965873 CGGGCATTGCCCTCCCACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298711 Original CRISPR CGCCCGGTTTCTGTAAGCAT TGG (reversed) Intronic