ID: 900298714

View in Genome Browser
Species Human (GRCh38)
Location 1:1965832-1965854
Sequence GCTTACAGAAACCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298701_900298714 29 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298700_900298714 30 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298708_900298714 -1 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298707_900298714 0 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298703_900298714 23 Left 900298703 1:1965786-1965808 CCAGCAGAACCAGGTGGCTTTTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298704_900298714 14 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298714 Original CRISPR GCTTACAGAAACCGGGCGGC GGG Intronic