ID: 900298714

View in Genome Browser
Species Human (GRCh38)
Location 1:1965832-1965854
Sequence GCTTACAGAAACCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298700_900298714 30 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298701_900298714 29 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298704_900298714 14 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298708_900298714 -1 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298707_900298714 0 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298703_900298714 23 Left 900298703 1:1965786-1965808 CCAGCAGAACCAGGTGGCTTTTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298714 Original CRISPR GCTTACAGAAACCGGGCGGC GGG Intronic
900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG + Intronic
904696704 1:32335488-32335510 ACTTACACAAAGCGGGAGGCTGG - Intronic
907404453 1:54245371-54245393 GCATACAGAATCTGGGGGGCCGG - Intronic
911413426 1:97540307-97540329 GCTTACAGAACCCGGGGTGGGGG + Intronic
915225003 1:154405562-154405584 GCTAATGGGAACCGGGCGGCAGG - Exonic
919655635 1:200194745-200194767 GCTTACAAAAACAGGTCTGCTGG - Intergenic
920437272 1:205955471-205955493 GCTCACAGAAACCTGGAGGAGGG + Intergenic
1070830938 10:79417806-79417828 GCTCAGAGAAACGGGGCAGCAGG - Intronic
1071532677 10:86401365-86401387 GGTTACAGCGTCCGGGCGGCCGG + Intergenic
1072610869 10:97017083-97017105 CCTTACAGAATGCGGGCTGCGGG - Intronic
1076640102 10:131909627-131909649 GCCTACAGAAAACAGGCAGCTGG + Intronic
1077817159 11:5697126-5697148 GTTTACAGAAACAGTGAGGCTGG - Intronic
1079237074 11:18698744-18698766 GCTGACAGAACCCCGGCGCCGGG + Intronic
1091397158 12:161004-161026 GCTGAAAGAAATCAGGCGGCGGG - Intronic
1096520822 12:52183626-52183648 GCGGATAGAAACCAGGCGGCAGG + Intronic
1126299995 15:47184594-47184616 GCGCACGGGAACCGGGCGGCGGG - Intronic
1129767772 15:78181110-78181132 GCTCACAGAACCCTGGTGGCAGG + Intronic
1143488943 17:7272520-7272542 CCTTACTGAAACCTGGCGTCTGG - Intergenic
1143627886 17:8121582-8121604 GTCTCCAGAAAGCGGGCGGCGGG + Exonic
1152315109 17:79575558-79575580 GCTTAGAGAAACCGGTTGGAGGG + Intergenic
1157665492 18:49483149-49483171 GCTTCCAGAAACGGGCCGGATGG + Intronic
1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG + Intronic
1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG + Intronic
1164822594 19:31261725-31261747 GCTTACAGAAACCGGGGGAGAGG + Intergenic
1166285136 19:41821136-41821158 GTTTACAGAAACCATGCTGCAGG + Intergenic
928511685 2:32009816-32009838 GCTTGCAGGAAGCGTGCGGCCGG - Intronic
938685445 2:133733364-133733386 GGTTACAGAAACCTGGCCACTGG - Intergenic
1174031882 20:47635432-47635454 GCTTACAGATGCCGAGCAGCAGG + Exonic
1174882887 20:54300221-54300243 TCATACAGAAACCCGGAGGCAGG + Intergenic
1179924360 21:44525886-44525908 GCCTTCAGAAACCAGGCCGCTGG - Intronic
954003939 3:47578074-47578096 GCTTAGAGGTACCGGGTGGCTGG - Intronic
962809210 3:138947048-138947070 GCTTCGGGAAACCGGGGGGCGGG - Exonic
962990473 3:140573064-140573086 GCTTACAGAAACCTGGCAGGTGG - Exonic
966217063 3:177514852-177514874 ACTTAGAGAAACTGGGAGGCAGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1030121057 7:106111770-106111792 TCTAACCGAAACCCGGCGGCCGG - Intronic
1032189907 7:129758912-129758934 GCTCACAGAAACCAGGAGACTGG + Intergenic
1032795377 7:135271949-135271971 GTTTACAAAACCCGGGGGGCTGG - Intergenic
1035672097 8:1425946-1425968 GCTTATGGAAACCAGGTGGCTGG + Intergenic
1042875016 8:73433848-73433870 GCTTACTGAAACAGAGCTGCGGG + Intronic