ID: 900298715

View in Genome Browser
Species Human (GRCh38)
Location 1:1965843-1965865
Sequence GGAGGGCAATGCCCGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298715_900298719 -9 Left 900298715 1:1965843-1965865 CCGGGCGGCGGGCATTGCCCTCC 0: 1
1: 0
2: 2
3: 13
4: 129
Right 900298719 1:1965857-1965879 TTGCCCTCCCACGTGGGACAGGG 0: 1
1: 0
2: 0
3: 8
4: 116
900298715_900298718 -10 Left 900298715 1:1965843-1965865 CCGGGCGGCGGGCATTGCCCTCC 0: 1
1: 0
2: 2
3: 13
4: 129
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298715 Original CRISPR GGAGGGCAATGCCCGCCGCC CGG (reversed) Intronic