ID: 900298716

View in Genome Browser
Species Human (GRCh38)
Location 1:1965850-1965872
Sequence GCGGGCATTGCCCTCCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298707_900298716 18 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298716 1:1965850-1965872 GCGGGCATTGCCCTCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
900298711_900298716 0 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298716 1:1965850-1965872 GCGGGCATTGCCCTCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
900298708_900298716 17 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298716 1:1965850-1965872 GCGGGCATTGCCCTCCCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298716 Original CRISPR GCGGGCATTGCCCTCCCACG TGG Intronic