ID: 900298717 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:1965851-1965873 |
Sequence | CGGGCATTGCCCTCCCACGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 72 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 65} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900298708_900298717 | 18 | Left | 900298708 | 1:1965810-1965832 | CCTGACAGTAGAGGTGGCCAATG | 0: 1 1: 0 2: 0 3: 7 4: 88 |
||
Right | 900298717 | 1:1965851-1965873 | CGGGCATTGCCCTCCCACGTGGG | 0: 1 1: 0 2: 0 3: 6 4: 65 |
||||
900298707_900298717 | 19 | Left | 900298707 | 1:1965809-1965831 | CCCTGACAGTAGAGGTGGCCAAT | 0: 1 1: 0 2: 0 3: 10 4: 86 |
||
Right | 900298717 | 1:1965851-1965873 | CGGGCATTGCCCTCCCACGTGGG | 0: 1 1: 0 2: 0 3: 6 4: 65 |
||||
900298711_900298717 | 1 | Left | 900298711 | 1:1965827-1965849 | CCAATGCTTACAGAAACCGGGCG | 0: 1 1: 0 2: 0 3: 4 4: 26 |
||
Right | 900298717 | 1:1965851-1965873 | CGGGCATTGCCCTCCCACGTGGG | 0: 1 1: 0 2: 0 3: 6 4: 65 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900298717 | Original CRISPR | CGGGCATTGCCCTCCCACGT GGG | Intronic | ||