ID: 900298717

View in Genome Browser
Species Human (GRCh38)
Location 1:1965851-1965873
Sequence CGGGCATTGCCCTCCCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298708_900298717 18 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298717 1:1965851-1965873 CGGGCATTGCCCTCCCACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 65
900298707_900298717 19 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298717 1:1965851-1965873 CGGGCATTGCCCTCCCACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 65
900298711_900298717 1 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298717 1:1965851-1965873 CGGGCATTGCCCTCCCACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298717 Original CRISPR CGGGCATTGCCCTCCCACGT GGG Intronic