ID: 900298718

View in Genome Browser
Species Human (GRCh38)
Location 1:1965856-1965878
Sequence ATTGCCCTCCCACGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298707_900298718 24 Left 900298707 1:1965809-1965831 CCCTGACAGTAGAGGTGGCCAAT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87
900298715_900298718 -10 Left 900298715 1:1965843-1965865 CCGGGCGGCGGGCATTGCCCTCC 0: 1
1: 0
2: 2
3: 13
4: 129
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87
900298711_900298718 6 Left 900298711 1:1965827-1965849 CCAATGCTTACAGAAACCGGGCG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87
900298708_900298718 23 Left 900298708 1:1965810-1965832 CCTGACAGTAGAGGTGGCCAATG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 900298718 1:1965856-1965878 ATTGCCCTCCCACGTGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298718 Original CRISPR ATTGCCCTCCCACGTGGGAC AGG Intronic