ID: 900298823

View in Genome Browser
Species Human (GRCh38)
Location 1:1966402-1966424
Sequence TTAGCTGAGCCCGAGATCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298823_900298828 5 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298828 1:1966430-1966452 CCTCCTCTGAGCTGGCCCCGGGG 0: 1
1: 0
2: 1
3: 43
4: 295
900298823_900298826 4 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298826 1:1966429-1966451 TCCTCCTCTGAGCTGGCCCCGGG 0: 1
1: 0
2: 2
3: 47
4: 405
900298823_900298824 -3 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298824 1:1966422-1966444 TAACGTTTCCTCCTCTGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 98
900298823_900298825 3 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298825 1:1966428-1966450 TTCCTCCTCTGAGCTGGCCCCGG 0: 1
1: 2
2: 3
3: 44
4: 341
900298823_900298834 27 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298834 1:1966452-1966474 GTCCCCCTGGATAAGCTCACTGG 0: 1
1: 0
2: 0
3: 3
4: 84
900298823_900298830 14 Left 900298823 1:1966402-1966424 CCAGAGATCTCGGGCTCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 900298830 1:1966439-1966461 AGCTGGCCCCGGGGTCCCCCTGG 0: 1
1: 0
2: 1
3: 41
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298823 Original CRISPR TTAGCTGAGCCCGAGATCTC TGG (reversed) Exonic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
904943863 1:34184771-34184793 TTAGGTGAACCCGACTTCTCTGG + Intronic
906874577 1:49523131-49523153 ATAGCTGAATCCCAGATCTCAGG - Intronic
908219440 1:61989610-61989632 TTAGCTGAGCACCAGATTTGAGG - Intronic
911502749 1:98708863-98708885 TCTGTTGAGCCTGAGATCTCTGG + Intronic
915268646 1:154736063-154736085 TGAGCTGAGCCAGTGATCTTGGG + Intronic
916218489 1:162419787-162419809 TGGGCGGAGCCCGAGAGCTCTGG + Intergenic
1063879840 10:10519903-10519925 TTAGATGAGCCCCAGACCTCTGG + Intergenic
1067275437 10:44829171-44829193 TTAGCAGAGCAGGAGAACTCAGG - Intergenic
1068157123 10:53214520-53214542 TCAGCTTAGCCAGAGATCCCAGG + Intergenic
1072612057 10:97024017-97024039 TTTGCTGAGTCAGAGAACTCTGG - Intronic
1085099806 11:73790968-73790990 TCACCTGAGCCCGGGATATCGGG - Intronic
1095095344 12:38144900-38144922 TCAGTGGAGCCCGAGAGCTCTGG + Intergenic
1095475639 12:42584764-42584786 TTATCTGAGGCAGAGATCCCTGG - Intronic
1099167052 12:79319684-79319706 TTAGCTGCTCCCAAGATTTCTGG + Intronic
1103179585 12:118898407-118898429 TTAGCTGAGCCTGAGAATTTAGG + Intergenic
1107331418 13:39305091-39305113 ATAGCTGAGGCAGAGCTCTCTGG + Intergenic
1116926810 14:50647469-50647491 TTACTTGAGCCCAAGATTTCAGG + Intronic
1120465489 14:84851723-84851745 ATAGCTGAGCCTGAGCTTTCAGG + Intergenic
1122071513 14:99208324-99208346 TTCCCTGAGCCCCAGATCCCAGG + Intronic
1128466359 15:67915815-67915837 ATAGCTGAGCTCGAGATGGCAGG - Intergenic
1128955611 15:71940273-71940295 TTACTTGAGCCCGAGAGTTCAGG + Intronic
1129188312 15:73923661-73923683 TGAGCTGAGCCAGAGCTGTCTGG - Intergenic
1133229837 16:4361275-4361297 ATTGCTGAGCCCAAGACCTCTGG + Intronic
1138585896 16:57970300-57970322 TTAGCTCAGCCCTGGCTCTCGGG - Intronic
1142416822 16:89947832-89947854 TAAACTGAGCCCGCGAGCTCAGG + Intergenic
1143916995 17:10301533-10301555 TTAGCTGGCCCCTATATCTCAGG + Intronic
1152646340 17:81470381-81470403 TTTGCTGAGACTGAGTTCTCAGG + Intergenic
1159876716 18:73820560-73820582 TCAGCTGAGCCAGACATCCCAGG - Intergenic
1165342497 19:35223030-35223052 TTAGCTGAGCCCTCCATCTGAGG + Intergenic
1167720429 19:51176068-51176090 TGAGCTGAACCCCAGATCTCTGG - Intergenic
1168413900 19:56156948-56156970 TTTTCTGTGCCCAAGATCTCTGG + Intronic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
929559561 2:42947475-42947497 TCAGCTGAGACTGAGCTCTCTGG - Intergenic
937453457 2:122021703-122021725 TTAGCTAAACCCAAGCTCTCTGG - Intergenic
1185307320 22:50127221-50127243 GAAGCAGAGCCAGAGATCTCAGG + Intronic
950515989 3:13465696-13465718 TTAGCTGACTGTGAGATCTCAGG + Intergenic
954388030 3:50254618-50254640 GTGGCTGGGCCAGAGATCTCAGG - Intronic
955811594 3:62796337-62796359 TCACTTGAGCCCAAGATCTCTGG - Intronic
962752695 3:138445442-138445464 TTATCTGAGCCACAGATCCCTGG + Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
975307782 4:72868499-72868521 TTAGCAGAGCCCGAGCACTGTGG - Intergenic
975314334 4:72933793-72933815 TTAGATGAGCCCTAGATGACAGG - Intergenic
980402299 4:132307156-132307178 TTAGCTGAGACCATGATCTTGGG - Intergenic
983758630 4:171376114-171376136 TTAGCTGACCCTGAGTTCACAGG - Intergenic
992396707 5:76375260-76375282 TTAGGGGAGCCAGAGAGCTCAGG - Intergenic
995945584 5:117641160-117641182 TTTGCAGAGCCCGAGAGCTCTGG - Intergenic
1000267750 5:159654363-159654385 GTTGCTGAGCCAGACATCTCAGG + Intergenic
1003110620 6:3249530-3249552 GTAGCTGGGCCTGAGATGTCAGG - Intronic
1014561295 6:122893987-122894009 TCAGCTGACCCTGACATCTCTGG + Intergenic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG + Intronic
1023185813 7:37531746-37531768 TCAGCCGAGCCCTAGATCTGGGG + Intergenic
1026930340 7:74220103-74220125 ATAGCTGAGCCCTGGAGCTCTGG - Intronic
1033007169 7:137578725-137578747 TTATCTCAGCCCGATATCCCTGG - Intronic
1046027472 8:108742700-108742722 GTAGCTGAGCAAGAGAGCTCAGG - Intronic
1047573125 8:126122737-126122759 GCAGCTGAGCCCAAGGTCTCAGG + Intergenic
1049199758 8:141334333-141334355 TGAGCTGAGCCCCAGGGCTCTGG - Intergenic
1049255984 8:141614165-141614187 TTTGTTGAGCCAGAAATCTCAGG + Intergenic
1051771051 9:20580070-20580092 GTAGCTGAGCCAGAGCTCTTGGG - Intronic
1060850207 9:126868808-126868830 TTACTTGAGCCCTAGATCTGTGG + Intronic
1203544182 Un_KI270743v1:116973-116995 TGAGCTGAGGCTGAGATGTCTGG - Intergenic
1185533836 X:842180-842202 TTCCCTGAGGCCGAGATGTCAGG - Intergenic
1185533902 X:843351-843373 TTCCCTGAGGCCGAGATGTCAGG + Intergenic
1185831022 X:3303235-3303257 TTAGATGAGCCCTAAATCTATGG + Intergenic
1186055909 X:5649467-5649489 TTAGCTTGGCCCGATAGCTCAGG + Intergenic
1186600716 X:11034176-11034198 TGGGCGGAGCCCGAGAGCTCTGG + Intergenic
1191608182 X:63083811-63083833 ATTGCTGAGGCCCAGATCTCTGG - Intergenic
1201765864 Y:17573115-17573137 TCAGCAGAGCTCGAGAGCTCTGG - Intergenic
1201835688 Y:18332874-18332896 TCAGCAGAGCTCGAGAGCTCTGG + Intergenic
1201914470 Y:19167626-19167648 TGGGCAGAGCCCGAGAGCTCAGG + Intergenic