ID: 900300464

View in Genome Browser
Species Human (GRCh38)
Location 1:1974333-1974355
Sequence TGGGTGACTCAGAGCGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900300464_900300478 28 Left 900300464 1:1974333-1974355 CCATCTCCGCTCTGAGTCACCCA 0: 1
1: 0
2: 2
3: 22
4: 253
Right 900300478 1:1974384-1974406 AACCTCAGGAAAATCACTATGGG 0: 1
1: 1
2: 1
3: 9
4: 180
900300464_900300472 14 Left 900300464 1:1974333-1974355 CCATCTCCGCTCTGAGTCACCCA 0: 1
1: 0
2: 2
3: 22
4: 253
Right 900300472 1:1974370-1974392 CCCTGCCTGCCTCCAACCTCAGG 0: 1
1: 0
2: 6
3: 83
4: 572
900300464_900300477 27 Left 900300464 1:1974333-1974355 CCATCTCCGCTCTGAGTCACCCA 0: 1
1: 0
2: 2
3: 22
4: 253
Right 900300477 1:1974383-1974405 CAACCTCAGGAAAATCACTATGG 0: 1
1: 0
2: 3
3: 15
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900300464 Original CRISPR TGGGTGACTCAGAGCGGAGA TGG (reversed) Intronic
900300464 1:1974333-1974355 TGGGTGACTCAGAGCGGAGATGG - Intronic
900319458 1:2075377-2075399 TGGGTGAGTCAGAGCTGGGATGG + Intronic
900372158 1:2336880-2336902 TGAGGGGCTCAGGGCGGAGACGG + Intronic
900702163 1:4055185-4055207 TCTGTGACTCAGAGGGCAGAGGG + Intergenic
901510766 1:9717124-9717146 GGGGTGGCTCAGAGGGGAGGCGG - Intronic
901632683 1:10655578-10655600 TGGGGGGCTCAGAGCCGGGAGGG + Intronic
902031737 1:13427940-13427962 TGGGTCTCTCACAGCAGAGATGG + Intergenic
902038720 1:13476651-13476673 TGAATTACTCAGAGCGGGGATGG + Intronic
903450937 1:23453168-23453190 TGAGAGAGTCAGAGAGGAGAAGG - Intronic
903971665 1:27122840-27122862 AGGATGACTCACAGGGGAGAGGG + Intronic
904400506 1:30253667-30253689 TGGGTGGCTCAGTGTGGAGCTGG + Intergenic
904675493 1:32196842-32196864 TGTGTGACTGAGACCAGAGATGG + Exonic
905522296 1:38609522-38609544 TGGGTGGCTCTCAGCGGAAAGGG + Intergenic
905885872 1:41491638-41491660 TTGGTGACCCAGAGCAGAGGAGG - Intergenic
907527530 1:55062716-55062738 GGGGTGCCTCAGAGGGGACAGGG + Intronic
907946892 1:59143787-59143809 TGTGGGACACAGAGCGGAGGTGG + Intergenic
912552309 1:110492214-110492236 TGGGTGAAGCAGAGGGGACAAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
918942938 1:191026032-191026054 TGGGTGTCGCAGAGCGGGGGCGG + Intergenic
919382668 1:196878082-196878104 TGGGGGACCCGGAGCGGAGCCGG - Intronic
920290925 1:204922690-204922712 TGGGTGCCTCAGACTGGAGGAGG - Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923678002 1:236097116-236097138 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678009 1:236097145-236097167 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678016 1:236097174-236097196 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678023 1:236097203-236097225 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678030 1:236097232-236097254 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678037 1:236097261-236097283 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678044 1:236097290-236097312 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678051 1:236097319-236097341 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678057 1:236097348-236097370 GGGGTGACTCAGAATGGAGCAGG + Intergenic
923678063 1:236097377-236097399 GGGGTGACTCAGAATGGAGCAGG + Intergenic
924443307 1:244104568-244104590 TGGGTGACTCAGAGCGTGGAGGG - Intergenic
1063020161 10:2119049-2119071 GGGACGACTCAAAGCGGAGAGGG - Intergenic
1066145009 10:32548371-32548393 AGGGTGACTCAGGACGGAGCAGG + Intronic
1067015796 10:42755533-42755555 TGGGTGCCTGGGAGCAGAGACGG + Intergenic
1067166342 10:43869106-43869128 GGGGTGGCTCAGAGCAGACAGGG + Intergenic
1069744849 10:70708639-70708661 TGGGCGACACAGAGCGGAAGCGG + Exonic
1070749811 10:78957338-78957360 TGGTTGACTCAGAGAGGACAAGG - Intergenic
1075097758 10:119483756-119483778 TGGGTGGAACAGAGCAGAGACGG + Intergenic
1075739675 10:124686905-124686927 TGTGTGACTCAGCAAGGAGATGG + Intronic
1076575252 10:131461572-131461594 GGGCTGGCTCAGAGCTGAGAGGG - Intergenic
1076698293 10:132257474-132257496 GGAGTGACTCAGAGCAGGGAGGG + Intronic
1076922567 10:133462184-133462206 TGGGTGGCCCAGAGCTGAGCAGG - Intergenic
1077889125 11:6405969-6405991 TGTGTGACTCAGTCAGGAGATGG - Intronic
1080110914 11:28566839-28566861 CGGGTGACTCAGAGCGCAGGAGG + Intergenic
1082085075 11:48043642-48043664 GGGGAGACTCAGGGCAGAGAAGG - Intronic
1083170198 11:60919614-60919636 TGGGATAATCAGAGCTGAGAGGG + Intronic
1083453445 11:62762012-62762034 TGGCTGCCTGAGAGAGGAGAGGG - Intronic
1083543702 11:63533486-63533508 TGGGTGATGGAGAGGGGAGAGGG - Intergenic
1083579787 11:63817789-63817811 TGGGTCACTGCGAGGGGAGAGGG - Exonic
1084410602 11:69004117-69004139 TGGGGGCCTCCGAGCTGAGAAGG + Intergenic
1084571586 11:69962979-69963001 TGAGTGTCTCAGAGCAGAGCAGG - Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1084988246 11:72897071-72897093 TGGGAGGCTGAGAGCTGAGATGG - Intronic
1089018964 11:115191689-115191711 TGGGAGGCTCAGATAGGAGATGG + Intronic
1089177056 11:116556681-116556703 TGGGAGACCCAGAGGAGAGAAGG + Intergenic
1090712967 11:129404405-129404427 AGGGTGACACATAGCAGAGATGG + Intronic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102184970 12:110940910-110940932 TGGGTGGCTCAGAGCAGTCAGGG - Intergenic
1102495085 12:113314176-113314198 AGAGTGACTCAGAGCTGAAAAGG - Intronic
1102823407 12:115926816-115926838 TGGGTGACGGAGAGAGGAGGAGG - Intergenic
1104809541 12:131612004-131612026 TGGGCGGCTCACAGCGGAGTGGG - Intergenic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107889518 13:44902096-44902118 TGGGTGGCTCAAAGCTGAGATGG - Intergenic
1110862188 13:80355865-80355887 TGGGCGCCTCAGAGCAGGGATGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111217225 13:85159776-85159798 TGGGGGAGCCAGAACGGAGATGG - Intergenic
1112548803 13:100400103-100400125 TGGGTGAATCAGTGGGGATATGG + Intronic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115410345 14:33067114-33067136 TGGGCCACACAGACCGGAGAGGG - Intronic
1115961370 14:38838209-38838231 GGGGAGACTCAGAGCTGAGGCGG + Intergenic
1118778754 14:68991934-68991956 TGGGTAACTCAGAGAGGTTAGGG - Intergenic
1119113636 14:71998150-71998172 AGGAAGACTCAAAGCGGAGAGGG + Intronic
1119386319 14:74259932-74259954 TGGGGGACTCAGAGCAGGGTGGG + Intronic
1121605035 14:95234354-95234376 TGGGCGTCTCAAAGCGGAGAAGG - Intronic
1122201123 14:100123354-100123376 AGGGTGATTGAGAGAGGAGATGG + Intronic
1122383063 14:101323735-101323757 GGGGTGACTCAGGACGGAGCAGG - Intergenic
1122789942 14:104179908-104179930 CGGGAGTCTCAGAGAGGAGACGG + Intronic
1128085986 15:64887045-64887067 TGGCTGACCCAAAGCGGAGTTGG + Intronic
1134111226 16:11516488-11516510 GGGGTGGCTCAGAGCAGAGTTGG - Intronic
1138478417 16:57285219-57285241 TGGGAGACCCAGCGCGGGGAAGG + Intergenic
1138902972 16:61296754-61296776 TGGGTGGCTCACAGTGGAAAGGG + Intergenic
1139658797 16:68405991-68406013 AGGGTGCCTCAGAGGGGACAAGG - Intronic
1141895364 16:86955598-86955620 GGGGTGGGTCAGAGGGGAGACGG - Intergenic
1142031209 16:87839464-87839486 TGGGGGAGTCAAAGGGGAGAAGG - Intronic
1142567927 17:852666-852688 GGGCTGACTCAGAGAGCAGACGG - Intronic
1143067893 17:4264071-4264093 TGGGTGAATGAAAGCGGAGGGGG + Intergenic
1144413752 17:15025817-15025839 CGGGTGACTCAAAGCAAAGAGGG - Intergenic
1147338719 17:39741453-39741475 TGAGTGATGCAGAGGGGAGAAGG - Intronic
1147868807 17:43572590-43572612 TCAGTGACTCAGAGTAGAGAAGG + Intronic
1149450049 17:56743007-56743029 TGGGCAACTGAGAGCGGGGAAGG - Intergenic
1150268800 17:63849321-63849343 CGGGCGACTGAGAGCGGAGCGGG + Intergenic
1151214606 17:72569114-72569136 AGGGGGACTCAGAGCCGAGGAGG - Intergenic
1151906913 17:77054753-77054775 GGGGAGACTGAGAGAGGAGAAGG + Intergenic
1152295818 17:79466371-79466393 TGGGTGACCCAGGATGGAGAAGG + Intronic
1152546299 17:81001619-81001641 AGGGTGGCTCAGAGTGGAGGAGG + Intronic
1152894867 17:82905284-82905306 TGGGTAACTCAGACAGGAGAGGG - Intronic
1154018758 18:10644249-10644271 GGAGTGAATCAGAGAGGAGATGG - Intergenic
1154185470 18:12179173-12179195 GGAGTGAATCAGAGAGGAGATGG + Intergenic
1154507957 18:15061030-15061052 TGTGGGCCTCAGAGCGGGGAAGG - Intergenic
1157181971 18:45506147-45506169 TGTGTGAGTCAGAGCTGGGAGGG - Intronic
1157596370 18:48866427-48866449 TGGGTGACTCAGGGCTGGGGAGG + Intergenic
1157847579 18:51017918-51017940 TGGGAGCCTCAGAGCAGTGATGG + Intronic
1158323070 18:56284649-56284671 TGGGGGGATCAGAGGGGAGAAGG - Intergenic
1158904378 18:61997979-61998001 TCCGTGACTCAGAATGGAGAGGG + Intergenic
1159345771 18:67201207-67201229 TGGGGGAACCAGAGGGGAGATGG + Intergenic
1159598369 18:70405229-70405251 TGAGTGACTCAGAGCAGAGCAGG + Intergenic
1161606910 19:5220172-5220194 TGGGTGGCTCAGAGCTCAGCTGG + Intronic
1161646904 19:5458683-5458705 AGAGTGAGTCAGAGGGGAGAGGG + Intergenic
1162298870 19:9832465-9832487 TGGGTGTCTCACTGTGGAGAAGG + Intergenic
1162687495 19:12400179-12400201 TGGAAGACTCAGAGGGGAAACGG + Intronic
1162691807 19:12440021-12440043 TGGAAGACTCAGAGGGGAAACGG + Intronic
1163831710 19:19550282-19550304 TGGGTGAGTCAAAGGGGAGCTGG - Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1165178681 19:33949023-33949045 TGGGTGAGTGAGAGAAGAGATGG - Intergenic
1166896015 19:46022362-46022384 AGGCTGACTCAGTGCGGAGCTGG - Intronic
1166955148 19:46459036-46459058 TGGGTGTCTCAGTAAGGAGAAGG - Intergenic
1167211244 19:48135532-48135554 GGGGTGACTGAGAGCAGAGGTGG - Intronic
1167671478 19:50856169-50856191 TGGGGGACTCGGATAGGAGATGG - Intronic
925472202 2:4174841-4174863 AGTGTGACCCAGAGTGGAGAGGG + Intergenic
925831747 2:7903172-7903194 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831789 2:7903383-7903405 TGGGAGACTCTGTGAGGAGATGG - Intergenic
925831802 2:7903460-7903482 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831811 2:7903517-7903539 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831826 2:7903594-7903616 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831834 2:7903631-7903653 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831839 2:7903651-7903673 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925831851 2:7903708-7903730 TGGGGGACTCTGTGAGGAGATGG - Intergenic
925930409 2:8702784-8702806 GGGATGACTCAAAGCGGGGAGGG + Intergenic
925984570 2:9206113-9206135 TGAGTGCTTCAGAGCGGTGAGGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
927175112 2:20400379-20400401 GGGGTGACTCTAAGAGGAGAGGG + Intergenic
927688957 2:25193926-25193948 TGGGAGAGTCAGCGCGGAGGTGG + Intergenic
930001858 2:46866958-46866980 TGGGTGACTCTGTGTGGGGATGG + Intergenic
930454019 2:51581901-51581923 TGGGCGAATCAGAACGGAGATGG - Intergenic
930657554 2:54021248-54021270 TGGGTGACTCAGGATGGAGCAGG + Intronic
931881895 2:66577266-66577288 TGGGGGTCTCAGTGGGGAGATGG + Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932821951 2:74909111-74909133 TGGGTGGCTCTCAGCGGAAAGGG - Intergenic
933894135 2:86795045-86795067 CGGGTGACACAGAGAAGAGAAGG - Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
937250023 2:120517716-120517738 GTGGGGACTCAGAGCAGAGAGGG - Intergenic
937802513 2:126096964-126096986 TGGGTGATTCAGAGTGTACATGG - Intergenic
939509033 2:143083859-143083881 TGAGTGAGTCAGAGAGGAAATGG + Intergenic
945483180 2:210365660-210365682 GGGGTGACTCAGGACGGAGCAGG + Intergenic
946426748 2:219602577-219602599 TGAGTGCCTCAGAGGGAAGAGGG + Intronic
946667528 2:222066670-222066692 TGGGAGACGCAGAGGGGAGGGGG - Intergenic
946755883 2:222947071-222947093 GGGGTGACTCACAGCGGGGTTGG - Intergenic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
947478347 2:230472803-230472825 TGGGTGAGTCAGAGGGGCCAGGG - Intronic
947593419 2:231397096-231397118 TGGGTGAGACAGACTGGAGAAGG + Intronic
947711985 2:232321654-232321676 TGGGCGACTCAGACAGGAAAGGG + Intronic
947731234 2:232432790-232432812 TGGGCGACTCAGACAGGAAAGGG + Intergenic
948901160 2:240957549-240957571 TCGGTGACTCGGAGCCGGGATGG + Intronic
1169016595 20:2297715-2297737 TGAGTGACTCGGAGCTGAGCTGG - Intronic
1169068912 20:2709763-2709785 TGGGTGGCTCTGAGCAGAGAGGG + Intronic
1170261842 20:14417539-14417561 TTGGTTACTCATAGGGGAGATGG + Intronic
1171229861 20:23475602-23475624 TGTGGGACCCAGAGCTGAGAAGG + Intergenic
1172628458 20:36362310-36362332 TGGGTGAGTGAAAGAGGAGAAGG + Intronic
1175958488 20:62623292-62623314 TGGTTCACTCAGAGCGGAGCTGG + Intergenic
1176259061 20:64169516-64169538 TGGGAAACTCAGAGCCAAGAGGG - Intronic
1176611783 21:8990651-8990673 TGAGTTACTGAGAGGGGAGAGGG - Intergenic
1176790124 21:13310767-13310789 TGTGGGCCTCAGAGCGGGGAAGG + Intergenic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178988820 21:37334252-37334274 TTGGGGACTCAGGGCGGAAAGGG + Intergenic
1179105608 21:38397675-38397697 TGGGTGACTCACAGTGGGAAGGG + Intronic
1180615222 22:17121757-17121779 TGCCTGCCTCAGAGCTGAGAAGG - Exonic
1180652094 22:17386239-17386261 TGAGTTACTCTGACCGGAGAGGG + Intronic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181422455 22:22811329-22811351 TGGGGGACCCAGAGAGGAGGGGG + Intronic
1182261139 22:29073495-29073517 TGGAAGACTCAAGGCGGAGAGGG - Intronic
1182270527 22:29150360-29150382 TGGGTGACTGAGCGGGGAAAAGG + Intronic
1184346623 22:43917645-43917667 TGGATGACTGAGAGGGGAGAGGG - Intergenic
1184376422 22:44116722-44116744 TGGGGGACTGAGAGCTGTGATGG + Intronic
1184424791 22:44403074-44403096 TGGCTGGCTCTGTGCGGAGATGG + Intergenic
1185132560 22:49047434-49047456 TGTGTGACTCAGAGAGCTGAGGG - Intergenic
950310586 3:11954442-11954464 TGGAAGACTCAAAGTGGAGAAGG - Intergenic
950575214 3:13828127-13828149 TGGGTGACTCAGACCAGTCAGGG + Intronic
950890817 3:16402159-16402181 TGGGTGACTCAGGTGTGAGATGG - Intronic
954635387 3:52068307-52068329 TGGATGCCTCAGAGAGGAAATGG + Intergenic
958004908 3:87798342-87798364 TGTGGGACCCAGAGCAGAGAGGG - Intergenic
959903509 3:111685658-111685680 TGGTTATCTCAGAGCTGAGAAGG + Intronic
960970246 3:123134483-123134505 TGGGTAACACAGAACGGGGAGGG - Intronic
961583508 3:127902943-127902965 TGGGTGATTGGGAGAGGAGATGG - Intergenic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961796723 3:129414400-129414422 TGTGTGACTCAGGGAGGACAAGG + Intronic
962411556 3:135145515-135145537 TGGGTGAATCAGAGCTGCTAGGG - Intronic
966059547 3:175738075-175738097 TGTGTGACTCAAAGAGGAGGAGG - Intronic
967846047 3:194043720-194043742 TGAGTGAGTCAGAGCTCAGATGG - Intergenic
968003673 3:195224953-195224975 TGGGTGGCTCAGACTTGAGAAGG - Intronic
968296072 3:197577498-197577520 TGGGTGACTGAACGGGGAGAAGG - Intergenic
970667358 4:18353431-18353453 TAGGTGTCTCAGAGCATAGAGGG - Intergenic
970797653 4:19933158-19933180 TGGGGGACTCAGTTCAGAGAGGG - Intergenic
970904539 4:21200621-21200643 TGGGAGACTCAAAGAAGAGAGGG + Intronic
972740130 4:41880628-41880650 TCGGTGGCTCAGAGCGGGAAGGG - Intergenic
973377962 4:49299885-49299907 TGAGTTTCTGAGAGCGGAGAAGG + Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
981532492 4:145765668-145765690 TGAATCACTCAGAGCTGAGAGGG + Exonic
982076521 4:151742447-151742469 TGGGTGACTCAGAATGGAGCAGG - Intronic
982849914 4:160300108-160300130 TGGGTGGCTCGGAAGGGAGACGG - Intergenic
982882679 4:160739913-160739935 TGTTTGATTCAGAGTGGAGAGGG - Intergenic
983679739 4:170339659-170339681 GGGGTGACTCAGAATGGAGCAGG - Intergenic
986580026 5:9256147-9256169 TGGGTGAGTCATAGAGGAAAGGG - Intronic
989161279 5:38393955-38393977 TGGGTGGCTCTCAGCGGAAAGGG + Intronic
994301918 5:98157476-98157498 TGGGGGAGTCAGAGGGGAGATGG + Intergenic
996001850 5:118373859-118373881 TGGGTCACTCAGAAGGCAGAGGG - Intergenic
997589655 5:135064941-135064963 TGGATGACCCAGAATGGAGAGGG + Intronic
998816396 5:146018255-146018277 TGGGAGACTCAAAGGAGAGAGGG - Intronic
1000298569 5:159934440-159934462 AGGGTGTCTCAGAGAAGAGAAGG - Intronic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1001216603 5:169862124-169862146 TGAGTGACTCAGAGCTGAGCTGG - Intronic
1001408929 5:171496495-171496517 AGGGTTCCTCAGAGAGGAGAGGG - Intergenic
1002361058 5:178671205-178671227 TGGGTGTCCCAGAGTGTAGACGG - Intergenic
1002841235 6:909162-909184 TGAGGGGCTCAGAGCTGAGAAGG - Intergenic
1002841246 6:909242-909264 TGAGGGGCTCAGAGCTGAGAAGG - Intergenic
1002841258 6:909322-909344 TGAGGGGCTCAGAGCTGAGAAGG - Intergenic
1002841270 6:909402-909424 TGAGGGGCTCAGAGCTGAGAAGG - Intergenic
1002992000 6:2246382-2246404 GAGGTGACTCAGAGCCGGGAGGG + Intergenic
1003255478 6:4471434-4471456 GGGGTGACTCAGGACGGAGAAGG - Intergenic
1005141328 6:22634881-22634903 TGGAAGACTCAGAAGGGAGAGGG - Intergenic
1005668309 6:28080036-28080058 GGGGTGACTCAGGACGGAGCAGG - Intergenic
1006829090 6:36958137-36958159 TGGGTGACCCTGAGGGGAGGTGG - Intronic
1010542325 6:77107200-77107222 TGTGTGACTCAGAGCAGCCAAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1019346187 7:531830-531852 GGGGTGAGACAGAGAGGAGAGGG + Intergenic
1019425583 7:975153-975175 CGGGTGAGTCAGGGCGGAGCCGG + Intronic
1020029902 7:4925415-4925437 TGGGGGGCTCAGGGCTGAGATGG - Intronic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1026272647 7:68850091-68850113 GTGGTGTCTCAGAGCTGAGAGGG - Intergenic
1032799383 7:135306291-135306313 TCGGGGACTCAAAGGGGAGAGGG - Intergenic
1036034352 8:5003183-5003205 TGGATGTGTCAGAGGGGAGAGGG + Intergenic
1037803345 8:22046706-22046728 TGTGTGGCTCAGAGGAGAGAGGG - Intronic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1038421722 8:27437963-27437985 TGGGTGACACAGAGCAGTGTTGG + Intronic
1039992394 8:42499389-42499411 GCGGTGAGTGAGAGCGGAGAAGG - Intronic
1041936508 8:63338014-63338036 TATGTGCCTCAGAGAGGAGAAGG + Intergenic
1042118361 8:65457496-65457518 TGCGTGACACTGAGCTGAGATGG + Intergenic
1042182356 8:66103734-66103756 TGGGTTAGTCAGAGAAGAGAAGG - Intergenic
1044911822 8:97068009-97068031 TGGGTGAATGAGAGTGCAGACGG + Intronic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1048996772 8:139799490-139799512 TGGGTGATTCAGAGAGGGTAAGG - Intronic
1052872219 9:33518371-33518393 TGTGTGAGTCAGAGGGGTGAGGG - Intergenic
1052909528 9:33868063-33868085 TGGGTGGCTCTCAGCGGAAAGGG + Intronic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1055049930 9:71968988-71969010 GGGGTGACTCAGGACGGAGCAGG + Intronic
1056098229 9:83275665-83275687 TAGGTAAATCAGAGAGGAGATGG - Intronic
1057063171 9:92023886-92023908 GGGGTCACCCAGAGAGGAGAAGG - Intergenic
1057210940 9:93200695-93200717 TGGGTGACTTAGAGGTGAGACGG + Intronic
1057943749 9:99306646-99306668 TGGCTGACCCAGAGCGGGGGAGG + Intergenic
1058608773 9:106752682-106752704 AGAGAGACTCAGAGAGGAGAAGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061217108 9:129227798-129227820 TGGTTGATTCAGAGCAGAGCTGG + Intergenic
1062140069 9:134951157-134951179 TGGCAGACTCAGGGCGGAAATGG + Intergenic
1062248381 9:135581917-135581939 TGGGTGAAGCACAGTGGAGATGG + Intergenic
1062276296 9:135733104-135733126 TGAATGACTCAGAGCCGACAAGG - Intronic
1187203841 X:17162112-17162134 TGGGTGAGTCAGAACAGAGTTGG + Intergenic
1189007243 X:37009142-37009164 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007369 X:37009754-37009776 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007415 X:37009970-37009992 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007436 X:37010078-37010100 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007488 X:37010294-37010316 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007561 X:37010618-37010640 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189669135 X:43388943-43388965 TGGATGACTCAAAGCAGGGAGGG + Intergenic
1192175506 X:68882474-68882496 TGGGTCTCTCAGAGGGCAGAAGG - Intergenic
1192215794 X:69157209-69157231 TGGGAGACACAGAGAGGAAAGGG + Intergenic
1194205391 X:91005594-91005616 AGGATGACTCAAAGTGGAGAAGG + Intergenic
1194274702 X:91865366-91865388 TAGGTGGCTCAGAACAGAGAGGG - Intronic
1198657687 X:138932576-138932598 TGGGCGACAGAGACCGGAGAGGG + Intronic
1200551208 Y:4580737-4580759 AGGATGACTCAAAGTGGAGAAGG + Intergenic
1200591945 Y:5086767-5086789 TAGGTGGCTCAGAACAGAGAGGG - Intronic