ID: 900305260

View in Genome Browser
Species Human (GRCh38)
Location 1:2003697-2003719
Sequence GGACCCAGGCCAGCCAGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 369}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900305260_900305276 29 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305276 1:2003749-2003771 CCCCGGGCTGCTCAGGCAGGCGG 0: 1
1: 0
2: 9
3: 54
4: 642
900305260_900305268 -2 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305268 1:2003718-2003740 CCCAGGTTCTCGGGCTCCGGAGG 0: 1
1: 0
2: 2
3: 16
4: 242
900305260_900305273 22 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305273 1:2003742-2003764 ACAGACACCCCGGGCTGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 165
900305260_900305271 13 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305271 1:2003733-2003755 TCCGGAGGCACAGACACCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 169
900305260_900305266 -5 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305266 1:2003715-2003737 GGTCCCAGGTTCTCGGGCTCCGG 0: 1
1: 1
2: 2
3: 17
4: 231
900305260_900305270 12 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305270 1:2003732-2003754 CTCCGGAGGCACAGACACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 188
900305260_900305274 26 Left 900305260 1:2003697-2003719 CCACCTCTGGCTGGCCTGGGTCC 0: 1
1: 0
2: 5
3: 38
4: 369
Right 900305274 1:2003746-2003768 ACACCCCGGGCTGCTCAGGCAGG 0: 1
1: 0
2: 7
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900305260 Original CRISPR GGACCCAGGCCAGCCAGAGG TGG (reversed) Exonic
900157989 1:1211219-1211241 GACCCCTGTCCAGCCAGAGGCGG + Intergenic
900226983 1:1537498-1537520 GTACCCAGGCCAGCCATGGTGGG - Intronic
900305260 1:2003697-2003719 GGACCCAGGCCAGCCAGAGGTGG - Exonic
900536527 1:3180564-3180586 AGACCCAGGCCAGCATCAGGAGG + Intronic
900558222 1:3290634-3290656 GGGCCCAGGCCGGCCAGCGCTGG + Intronic
900596978 1:3484361-3484383 GGACCGAGCCGAGCCAGAGGAGG - Intergenic
900599360 1:3496523-3496545 GGGCCAGGCCCAGCCAGAGGGGG + Intronic
900601356 1:3504103-3504125 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900601369 1:3504131-3504153 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900997530 1:6130487-6130509 GCACTCAGGGGAGCCAGAGGAGG + Intronic
901307052 1:8240262-8240284 GGTTACAGGCCAGCCATAGGAGG + Intergenic
901409439 1:9072077-9072099 GGACCCGGGCGAGGCTGAGGGGG - Intronic
902337979 1:15764812-15764834 GCACCCAGCCCAGCCAGAGAAGG - Intronic
902689346 1:18100262-18100284 TGACCCAGGCCAGAGAGGGGAGG + Intergenic
902764866 1:18607332-18607354 GGACCCATTCCAGAAAGAGGAGG - Intergenic
902985110 1:20150135-20150157 GAACCATGGCCAGCAAGAGGCGG - Exonic
903024090 1:20414737-20414759 GAACCCATGTCAGCCTGAGGAGG + Intergenic
903060228 1:20664065-20664087 GGCCACAGACCAGCCAGGGGTGG + Exonic
903438111 1:23367958-23367980 GGTCCCAGGTAAGCCGGAGGTGG - Exonic
904401986 1:30262876-30262898 GGAACCAGGACACACAGAGGAGG - Intergenic
904660027 1:32077156-32077178 CGACCCAGGCCTCTCAGAGGGGG + Exonic
904768987 1:32870674-32870696 AGACGCAGCCCAGCCACAGGCGG + Exonic
905382664 1:37574303-37574325 GGACCCATGCTCCCCAGAGGTGG + Intronic
905924158 1:41738089-41738111 GGACCCTGCCCTCCCAGAGGTGG - Intronic
906293119 1:44632452-44632474 AGACCCAGGCAAGCCAGGAGCGG - Intronic
906684131 1:47752132-47752154 GGACTCAGGCCAACAAGAAGAGG - Intergenic
906929512 1:50155452-50155474 GGACCCAGGCAAGAAAGATGAGG - Intronic
907290821 1:53411826-53411848 GGACCCTGCCCAGACATAGGGGG + Intergenic
910246878 1:85148568-85148590 AGGCCCAAGGCAGCCAGAGGTGG + Intergenic
910290792 1:85598589-85598611 GGCCACAGGCCAGCCAGACGAGG + Intergenic
912712300 1:111958706-111958728 GGACAGATGCCAGACAGAGGGGG - Intronic
912799781 1:112713734-112713756 GGATCCAGGCCAGAGGGAGGAGG + Intronic
914912947 1:151801588-151801610 GGAGCCGGAGCAGCCAGAGGAGG + Exonic
915359869 1:155279389-155279411 GGACACAGGGAGGCCAGAGGAGG + Intronic
915588991 1:156860131-156860153 TGACCCCGGCCAGCCAGCGCCGG - Intronic
915828539 1:159103854-159103876 TCACCCACGCCAGCCAAAGGAGG + Intronic
917081258 1:171258883-171258905 GGCCCCAGGCCAGGCAAGGGTGG - Intronic
919755596 1:201064236-201064258 GGACCCAAGCTTGGCAGAGGAGG + Intronic
919928917 1:202208712-202208734 GGAGGCAGGGCAGGCAGAGGGGG - Intronic
920369235 1:205467331-205467353 GGACCCAGAGAAGCCAGAAGAGG + Intergenic
921131234 1:212221743-212221765 GGGCCCAGGACAGCCTGAGAAGG - Intergenic
922505060 1:226121583-226121605 GGACCCAGGCCGGGCGGGGGAGG - Intergenic
922909001 1:229199701-229199723 GCACCCAGGCAGGCCAGAGAAGG - Intergenic
922937012 1:229430942-229430964 GGACCCAGGGCCACCAGCGGAGG + Intergenic
924384258 1:243487768-243487790 GGACCCCGCCCAGGCAGAGCCGG - Intronic
1063018750 10:2104920-2104942 GGGCACAGGGCAGCCGGAGGCGG + Intergenic
1063368965 10:5508536-5508558 GGACCCAGGGCAGCCGGTGAGGG - Intergenic
1065340018 10:24695938-24695960 GGACCCAGGTAAGCCAGACCTGG + Intronic
1066654508 10:37685846-37685868 GGAGCCAGGCCAGGGAGAGGTGG + Intergenic
1067039459 10:42941301-42941323 GGAGCCGGGCCAGGGAGAGGTGG + Intergenic
1067054460 10:43042851-43042873 ACACCCAGGCCAGCCAGTCGGGG - Intergenic
1067143131 10:43672846-43672868 GAACCCAGGCCTGCTAGAGCAGG - Intergenic
1067228079 10:44388185-44388207 CGGCCCAGGCCAGGCAGAGGGGG - Intergenic
1067695991 10:48536026-48536048 GGACCCAGGCCAGCCTCTGCCGG - Intronic
1068637913 10:59368252-59368274 GGTCCCAGTCCAGCCAGAAAGGG + Intergenic
1069634915 10:69919176-69919198 AGTCCCAGGCCAGCCTCAGGGGG - Intronic
1069831786 10:71286230-71286252 GGACCCAGGTCTGCCAGACCCGG + Intronic
1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG + Exonic
1071996349 10:91153311-91153333 GGGCCCAGGCAAGACAGAGCTGG + Intergenic
1072444810 10:95489785-95489807 GGAACCAGATCAGCCACAGGAGG - Intronic
1072631159 10:97147566-97147588 AGACCCAGGTGAGGCAGAGGTGG + Intronic
1073066005 10:100759572-100759594 GGACTGAGGGCAGGCAGAGGAGG - Intronic
1074060346 10:109959754-109959776 GGAGCCACCCCAGCCATAGGAGG - Intergenic
1076035487 10:127196059-127196081 GGACCCTGGCAAGCCTGGGGCGG + Exonic
1076430649 10:130399585-130399607 GGACGCAGGGCAGCCAAGGGAGG - Intergenic
1076721610 10:132395777-132395799 AGCCCCAGGCCACACAGAGGAGG + Intergenic
1076792692 10:132785539-132785561 TCACCCGGGCCAGCCAGACGCGG + Exonic
1077143914 11:1036435-1036457 GGACCCGGGCCTGGCAGCGGGGG + Intronic
1077269103 11:1666654-1666676 TGAGCCAGGCCAGCCCGGGGCGG - Intergenic
1077271444 11:1684060-1684082 TGAGCCAGGCCAGCCCGGGGCGG + Intergenic
1077378768 11:2218136-2218158 GAACACAGGCAAGCAAGAGGGGG - Intergenic
1077673934 11:4181250-4181272 AGCCCCTGGCCTGCCAGAGGTGG - Intergenic
1079095780 11:17509433-17509455 GGACACAGGCAATCCAGTGGAGG - Exonic
1079873542 11:25829749-25829771 GGACCCAATCAAGCCACAGGGGG + Intergenic
1080100365 11:28452691-28452713 GGATCCAGGCCAGACAGTGAGGG + Intergenic
1080125578 11:28729589-28729611 GGACCCAGGCCTGCCACAGGAGG - Intergenic
1080684251 11:34502414-34502436 TGACCCACCCCTGCCAGAGGGGG + Intronic
1080780871 11:35428942-35428964 GAACTCAGGGAAGCCAGAGGAGG - Intergenic
1081757904 11:45557678-45557700 GGACCCAAGCCAGAAAGAGGAGG - Intergenic
1081762448 11:45585721-45585743 GGGCCCAGGCAAGTCAGAGACGG - Intergenic
1082010814 11:47448672-47448694 GGACACAGGGGAGCCCGAGGAGG + Intronic
1082986726 11:59175467-59175489 GGGCCCAGGGCAAACAGAGGCGG - Intronic
1082999049 11:59275165-59275187 GGACCCTGTCCAGCCTGTGGTGG + Intergenic
1083271412 11:61574735-61574757 GGGCCCAGGCCTGGCAGAGCGGG + Intronic
1083340348 11:61955210-61955232 GGACCCGGAACAGCCAGAAGGGG - Intronic
1083827784 11:65212898-65212920 GGTCCCAGGTCATCCAGACGTGG - Intergenic
1084001359 11:66296813-66296835 GGCCCCAGGCTAGGCAGGGGAGG - Intergenic
1084303268 11:68265014-68265036 GGACACAGTTCAGCCAGTGGTGG + Intronic
1085197189 11:74679799-74679821 GGCCACTGACCAGCCAGAGGTGG - Intergenic
1086493062 11:87375221-87375243 GGACCCATGACAGCCTTAGGAGG + Intergenic
1088540033 11:110903921-110903943 GGAGCCAGTTTAGCCAGAGGGGG + Intergenic
1089665239 11:120013952-120013974 GTACCCAGGGCAGCCGGAGTGGG + Intergenic
1089776909 11:120844137-120844159 GGACCCAGGGCAGACAGAGAGGG + Intronic
1091020246 11:132092962-132092984 GGATCAGGGCCAGCCTGAGGTGG - Intronic
1094202936 12:27811667-27811689 AGAGCCAGGACAGCCAGTGGTGG + Intergenic
1096549429 12:52362539-52362561 GGAGCCAGGGCAGGGAGAGGAGG + Intronic
1096607591 12:52777709-52777731 GGACCCAGCCCACTCAGAAGAGG - Intergenic
1096666846 12:53171741-53171763 GGACCCAGGCCAGGCCAGGGAGG - Intronic
1097154374 12:57002106-57002128 GAACCCCTGCCAGCCAGAAGGGG - Exonic
1097729270 12:63109133-63109155 GGAGCCTGGTGAGCCAGAGGAGG + Intergenic
1098105755 12:67068581-67068603 CGTCGCAGCCCAGCCAGAGGCGG + Intergenic
1100565573 12:95790727-95790749 GGAGCCGGGGCAGCCAGAAGAGG - Exonic
1102585872 12:113922550-113922572 GCACCCAGGCCAGCAGGTGGAGG - Intronic
1103218559 12:119223758-119223780 GGACTCAGGGCAGGGAGAGGAGG - Intergenic
1103590285 12:121987293-121987315 GGCCCCTGCCCAGCGAGAGGTGG + Intronic
1103923280 12:124410535-124410557 TTTCCCAGGCCTGCCAGAGGAGG - Intronic
1104084419 12:125461149-125461171 GTACCCAGGAGAGCCAGAGCTGG + Intronic
1104286198 12:127426928-127426950 GTACCCAGGAGAGCCAGAGCTGG - Intergenic
1104911881 12:132243682-132243704 GGCCCCAGGACAGCCAGGTGGGG - Intronic
1106489099 13:30200578-30200600 GGAGCCAGGTCAGTCACAGGTGG + Intergenic
1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG + Intergenic
1108593121 13:51928042-51928064 GGACCCAGGGCACACTGAGGTGG + Intergenic
1111763448 13:92496487-92496509 GTACCCAGGGCAGGCAGATGAGG - Intronic
1112435297 13:99387607-99387629 GGAGCCATCCCAGCCAGAGGAGG + Intergenic
1113089704 13:106604202-106604224 GCACCTAGGCCAGCCAGAGGAGG + Intergenic
1113791959 13:113033683-113033705 AGCCTCAGGCCAGCCAGAGATGG - Intronic
1114031966 14:18586279-18586301 GGTCCCAGGCCGGCCTCAGGTGG - Intergenic
1114055738 14:18965861-18965883 GTGTCCAGGCCAGCAAGAGGGGG - Intergenic
1114074482 14:19149179-19149201 GGAGCCTGGGCAGCCAGAGAAGG - Intergenic
1114087786 14:19250796-19250818 GGAGCCTGGGCAGCCAGAGAAGG + Intergenic
1114106809 14:19435903-19435925 GTGTCCAGGCCAGCAAGAGGGGG + Intergenic
1114619104 14:24084380-24084402 GGACACAGGCCAGTCAGGGTGGG + Intronic
1115445697 14:33486739-33486761 GTCCCCAGGCCTGCCTGAGGAGG - Intronic
1116413215 14:44649772-44649794 GGCACCAGCTCAGCCAGAGGGGG + Intergenic
1117761029 14:59028745-59028767 GGACCCCGGGAAGCCACAGGAGG + Intergenic
1117779327 14:59216147-59216169 GGACCCTGGGAAGTCAGAGGAGG - Intronic
1118819779 14:69337738-69337760 GCACACAGGCTGGCCAGAGGTGG + Intronic
1118853773 14:69605623-69605645 GGTCCCTGGCCAGCCAAAAGAGG + Intergenic
1119406631 14:74403168-74403190 TGCCCCAGGCATGCCAGAGGCGG + Intergenic
1121643274 14:95500557-95500579 GGACACAGGCCAGCTCCAGGAGG - Intergenic
1122558419 14:102593375-102593397 GGTCCCCGGCGAGCCCGAGGGGG + Intronic
1123116344 14:105895865-105895887 GGACAGATGCCAGCCTGAGGTGG - Intergenic
1123118350 14:105904906-105904928 GGACAGATGCCAGCCTGAGGTGG - Intergenic
1126110115 15:45170013-45170035 GGAGCCAGGTCAGCCAGGGTGGG + Intronic
1126778664 15:52119965-52119987 TCTCCCAGGCGAGCCAGAGGTGG - Exonic
1128108830 15:65063496-65063518 GGGCCAAGGTCACCCAGAGGAGG - Intronic
1128212275 15:65910992-65911014 GGACCCATACCAGGCAGAGTGGG - Intronic
1128247080 15:66140457-66140479 GGGCCCAGGCCTGCCTGAGGAGG - Intronic
1128737690 15:70062534-70062556 GGCCGCCTGCCAGCCAGAGGCGG - Intronic
1129780257 15:78265018-78265040 GGGGCCAGGCCGGGCAGAGGTGG + Intronic
1129798743 15:78397457-78397479 TCACCCAGGCCAGCCAGGGCAGG + Intergenic
1130301218 15:82680808-82680830 GGGCCCAGCCCAGGCAGAGCGGG - Intronic
1130963761 15:88682168-88682190 GAGCCCAGGCCAGTCAGGGGAGG + Intergenic
1131377739 15:91939526-91939548 GCAGCCAGGCCTGGCAGAGGTGG + Intronic
1131530016 15:93182968-93182990 GGAATTAGCCCAGCCAGAGGAGG - Intergenic
1132221810 15:100110780-100110802 GGCCCCGGGCCAGCAAGAGCAGG + Intronic
1132346550 15:101112264-101112286 GGACCCAGCCCAGGCTGAGCTGG + Intergenic
1132585158 16:702955-702977 GGACTCTGGCCGGTCAGAGGAGG - Intronic
1132698989 16:1214234-1214256 GGAGCCAGGCAGGCCTGAGGTGG + Intronic
1132759200 16:1500724-1500746 AGACCCGGGCCAGCCACACGGGG - Intronic
1132866780 16:2097077-2097099 GGACTCAGGCCAGGCAGCCGTGG - Intronic
1133161607 16:3915692-3915714 GGACGCAGGGCAGGGAGAGGAGG + Intergenic
1134011108 16:10853818-10853840 GGTCCCAGGCTAGTCAGTGGTGG - Intergenic
1135159695 16:20082825-20082847 TGGCCCAGGGCAGTCAGAGGTGG + Intergenic
1135187293 16:20326374-20326396 AGACCAAGGCCAGCCACAGGAGG + Exonic
1135304925 16:21359860-21359882 GCACTCAGACCAGCCAGAGGTGG + Intergenic
1136301676 16:29339053-29339075 GCACTCAGACCAGCCAGGGGTGG + Intergenic
1136364826 16:29805194-29805216 GGGCGCAGGACAGGCAGAGGAGG - Intronic
1138377530 16:56576166-56576188 GGAGCCAGGGCTTCCAGAGGTGG - Intergenic
1139655856 16:68386963-68386985 GGACCCAGGCCAGGCGCAGGGGG + Intronic
1139952466 16:70679020-70679042 GGACGCAGGCCAGCCTGGTGGGG + Intronic
1141697296 16:85626104-85626126 GGACCCAGGGCAGCCTGGGGGGG + Intronic
1141700005 16:85638033-85638055 GGGCCCAGGGCACCCAGAGGAGG - Intronic
1141797790 16:86286616-86286638 GATCCCAGGCCAGCGGGAGGAGG + Intergenic
1141854210 16:86670075-86670097 GGACCCAGGCCCGCCCGTGGTGG + Intergenic
1142063360 16:88045612-88045634 GCATTCAGACCAGCCAGAGGTGG + Intronic
1142147351 16:88498152-88498174 TTCCCCAGGACAGCCAGAGGAGG - Intronic
1142196576 16:88741962-88741984 GGACCCAGGAGGGACAGAGGGGG - Intronic
1142266962 16:89068396-89068418 GGACAGAGTCCAGCCACAGGTGG + Intergenic
1142612408 17:1116509-1116531 TGAGCCAGGCCAGCCAGGTGTGG + Intronic
1143018381 17:3903871-3903893 GGTCCCAGGCCAGACAGAGGGGG - Intronic
1143375240 17:6463361-6463383 GCACACAGCCCAGCCACAGGGGG + Intronic
1143410440 17:6705185-6705207 GGACCCAGGCTAGGAGGAGGGGG + Intronic
1143434853 17:6915761-6915783 AGACCCAGGCTTGACAGAGGTGG - Intronic
1143444067 17:6996792-6996814 GGACCCAGGCCAGACTTAGTAGG - Intronic
1143585071 17:7846894-7846916 GTAGCCAGGCCAGGCAGGGGTGG - Exonic
1143867690 17:9935878-9935900 GCACCCAAGCCACCCAGAGGGGG - Intronic
1145889484 17:28405045-28405067 AGGCCAAGGCCAGCCAGAAGGGG + Exonic
1145905039 17:28511638-28511660 GTCCCCAGGACAGCCAGATGAGG + Intronic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1146802580 17:35838471-35838493 GGACACAGGAAAGCCAAAGGGGG + Exonic
1146941662 17:36847666-36847688 GGAAGCAGTCCAGACAGAGGAGG - Intergenic
1147563474 17:41522654-41522676 GGCCCCAGGCAAGCCAGGGTTGG + Intergenic
1148581130 17:48744835-48744857 AGACCCAGGCAATGCAGAGGAGG + Intergenic
1149482468 17:57015014-57015036 GGACCCAGCTAAGCCACAGGTGG - Intergenic
1150218134 17:63481509-63481531 GTCCCCAGGCCAGCCAGAGTGGG + Intergenic
1151474045 17:74335480-74335502 GGCCTCAGGCCAGGGAGAGGAGG - Intronic
1151560736 17:74868164-74868186 CATCCCAGGCCAGCCACAGGGGG + Intronic
1151727177 17:75891971-75891993 GGACCCAGGACAGCAGGGGGAGG + Intronic
1151825869 17:76523836-76523858 GGGCCCAGGCAAGCCAGAGCTGG - Intergenic
1151876348 17:76869817-76869839 GGGCCCAGGCCAGGCAGGGCTGG + Intronic
1152710562 17:81868860-81868882 GGACTGAGCCCAGCCAGAGGCGG - Exonic
1156450813 18:37265654-37265676 GGAGCCAGGCCAGGCAGAGGAGG - Intronic
1157312079 18:46560140-46560162 TGCCCCGGGCCAGCCAGCGGTGG + Intronic
1157598610 18:48879005-48879027 GCACCCAGGGCAGCCTGAGCAGG + Intergenic
1157945278 18:51972697-51972719 GGACCCAGGACAGTGGGAGGGGG - Intergenic
1160843084 19:1155099-1155121 GGACCCAGGCTGGCCCGTGGTGG + Intronic
1160966505 19:1749151-1749173 GGGCCCAGGCCTGCGAGACGGGG + Intergenic
1161367035 19:3885940-3885962 GGAACCAGGCCAGCCCCGGGCGG - Intronic
1161592850 19:5136581-5136603 GGTCCCAGGCCTGCCACAGCCGG + Intronic
1161636740 19:5393889-5393911 AGACCCTGGGTAGCCAGAGGGGG - Intergenic
1162101282 19:8340725-8340747 GGACCTCGGCCAGACAGAAGTGG - Intronic
1162522746 19:11191574-11191596 TGACCCAGGCCAGCCAATGAGGG + Intronic
1162834639 19:13308273-13308295 GGACTCAGGCCAGGCGGGGGAGG + Intronic
1162970425 19:14177823-14177845 GGACACAGCCGAGCCAGAGGTGG - Intronic
1163584695 19:18157329-18157351 GGACAGAGGCCAGGCAGAGGAGG - Intronic
1163605877 19:18274982-18275004 GGCCCCAGCCCAGCCCCAGGAGG - Intergenic
1163618014 19:18341025-18341047 GCCCGCAGGCCAGACAGAGGAGG - Intronic
1163650264 19:18513477-18513499 ACACCCAGGCGAGACAGAGGAGG + Intronic
1165006254 19:32809638-32809660 GGACCTAGGCAATCCAGAAGTGG - Intronic
1165642609 19:37403017-37403039 TGTCCCAAGCCAGCCAGAGCAGG - Intergenic
1165724178 19:38101005-38101027 GGAGGCAGGCCAGGCAGAGATGG - Intronic
1166763488 19:45238829-45238851 GGGCCCAGCCCAGCCGGAAGGGG + Intronic
1167002726 19:46755669-46755691 AGACCCAGCCCAGCCCGTGGTGG + Exonic
1167148300 19:47695207-47695229 GGACACAGGAAGGCCAGAGGTGG + Intronic
1168280658 19:55303808-55303830 TGGCCCAGCACAGCCAGAGGTGG + Exonic
1168346030 19:55650637-55650659 GGCCCAAGGGCAGCCAGAGGTGG - Intronic
925337389 2:3108275-3108297 AGACCCTGGCCAGACCGAGGAGG + Intergenic
925405271 2:3602026-3602048 GGGCTCTCGCCAGCCAGAGGCGG + Intronic
926042108 2:9681589-9681611 GGGCCCATGGCAGGCAGAGGAGG - Intergenic
927178033 2:20424093-20424115 AGACCCAGGGCAGGGAGAGGAGG - Intergenic
927872120 2:26630317-26630339 GCACCCAAGGCAGCCAGTGGAGG + Intronic
928037735 2:27841078-27841100 GGACCCAGGACAGCAGGAAGCGG - Intronic
928186444 2:29115375-29115397 GGAGCCAGGCGAGCCAGCGCAGG + Intronic
929776804 2:44935185-44935207 GAACCCGGCCCAGCCAAAGGGGG + Intergenic
929920946 2:46171185-46171207 GGCCCCAGGCAAGCCAGGGCAGG + Intronic
930088295 2:47513977-47513999 GGACACTGGCAAGCCAGTGGAGG - Intronic
930771785 2:55137066-55137088 GGGCTCTGGCCAGGCAGAGGAGG + Intergenic
931102216 2:59015171-59015193 AGCCCCAGGCCTGCCACAGGAGG + Intergenic
932192764 2:69754801-69754823 GGCCCCAGGACAGCCTTAGGAGG - Intronic
932697552 2:73969365-73969387 AGACCCAGGCCAGCTGCAGGTGG + Intergenic
933536209 2:83578164-83578186 GGACCCAGGCTGGACATAGGAGG - Intergenic
936373248 2:111920277-111920299 GGTCACAGCCCAGCCACAGGAGG - Intronic
937256292 2:120558113-120558135 GGACCTAGGCCAGCCAGGAGGGG - Intergenic
937288463 2:120767678-120767700 TGACCCAGGCGAGGCAGTGGGGG - Intronic
938133654 2:128736904-128736926 GGCTACTGGCCAGCCAGAGGGGG - Intergenic
938218903 2:129548809-129548831 GGGCCTGGGGCAGCCAGAGGGGG - Intergenic
938488820 2:131745675-131745697 GGAGCCTGGGCAGCCAGAGAAGG - Intronic
942752594 2:179304545-179304567 GGCCACATGCAAGCCAGAGGGGG + Intergenic
945988304 2:216371906-216371928 CGAGCCTAGCCAGCCAGAGGCGG - Exonic
946326801 2:218988831-218988853 TGCCCCAGGCCAGGCAGAGCAGG - Intergenic
947748197 2:232520150-232520172 GGCTGCAGGCCAGGCAGAGGGGG - Intergenic
947809969 2:232998058-232998080 GGACCCAGGCCAGAAGGTGGTGG + Intronic
948524972 2:238566034-238566056 GGACCCAGCCCAGAAAGACGGGG - Intergenic
948679991 2:239627166-239627188 GGACCCTGGCCAGCCACACAGGG - Intergenic
948852453 2:240715083-240715105 GGCCCCAGGCAGGCTAGAGGAGG - Exonic
1169343820 20:4814853-4814875 GTGCCCAGGGCAGACAGAGGAGG - Intronic
1170759952 20:19240511-19240533 GAAGCCAGGGAAGCCAGAGGAGG + Intronic
1171310663 20:24142324-24142346 GGTCACATGGCAGCCAGAGGTGG - Intergenic
1171769784 20:29313674-29313696 GGGCAAAGGCCAGCCAGGGGAGG + Intergenic
1172095371 20:32457625-32457647 GCAGCCAGGCCGGGCAGAGGGGG + Intronic
1172273992 20:33669979-33670001 GGACACAGGCCAGTGAGAAGTGG + Intronic
1172485253 20:35294031-35294053 GGAGCCAGGCTAGGCAGAAGCGG + Intergenic
1172635622 20:36407875-36407897 GGAAGCAGGGCAGCCAGGGGAGG + Intronic
1173251612 20:41366709-41366731 GGACCCGGGCCGACCAGCGGCGG - Exonic
1173499643 20:43543728-43543750 GGACACAGACCAGCCAGTAGAGG + Intronic
1173655645 20:44698640-44698662 CCACCCAGGCCAGCCAGAAGAGG + Intergenic
1175224366 20:57436291-57436313 TCATCCAGGCCAGCCAGAGTTGG - Intergenic
1175300804 20:57941435-57941457 GGATCCAGGCCAGGCAGGGTGGG + Intergenic
1175479307 20:59300419-59300441 GCACCCAGGACAGCGAGGGGCGG - Exonic
1175916613 20:62428778-62428800 GTTCCCAGGCCAGCCAGAGCTGG - Intergenic
1175924994 20:62467167-62467189 GGACCCGGGCCTGCCAGATTGGG - Intronic
1175998024 20:62820036-62820058 GGACACAGAGCAGCCAGAGGTGG - Intronic
1176052183 20:63125626-63125648 GGTCCAGGGACAGCCAGAGGTGG + Intergenic
1176068447 20:63213110-63213132 GGACACAGGCCAGTCAGTGGTGG + Intronic
1178430241 21:32512516-32512538 GTACCCAGGGCAGACAGAGTAGG - Intronic
1178905545 21:36633081-36633103 GGACCCTGGCCATGCAGAAGAGG + Intergenic
1179232737 21:39519673-39519695 GGACCAAAGCCAGGCGGAGGAGG - Intergenic
1179553247 21:42156605-42156627 AGACCGAGGGCAGCCAGAGCTGG - Intergenic
1179998840 21:44986112-44986134 GGGCCCAGGCCAGCCCGGGCAGG + Intergenic
1180044023 21:45294548-45294570 GGCCCCAGGCCACGGAGAGGCGG - Intergenic
1180290128 22:10842119-10842141 GGAGCCTGGGCAGCCAGAGAAGG - Intergenic
1180456080 22:15513336-15513358 GGTCCCAGGCCGGCCTCAGGTGG - Intergenic
1180474215 22:15688412-15688434 GTGTCCAGGCCAGCAAGAGGGGG - Intergenic
1180492926 22:15871541-15871563 GGAGCCTGGGCAGCCAGAGAAGG - Intergenic
1180612258 22:17105700-17105722 GAACCGAGGCCAGCCCGGGGTGG + Intronic
1180831642 22:18909901-18909923 AGACCCAGGGCAGCTGGAGGGGG - Intronic
1180949786 22:19715791-19715813 GGACACACCCCACCCAGAGGTGG + Intronic
1180970049 22:19810535-19810557 GGACCCAGCCCAGGTAGACGTGG - Intronic
1181012153 22:20047671-20047693 GGACCCAGCCCAGGGAGTGGGGG - Intronic
1181057828 22:20268241-20268263 GGCCCGAGCCCAGCCAGAGCCGG - Exonic
1181068215 22:20316488-20316510 AGACCCAGGGCAGCTGGAGGAGG + Intronic
1181436875 22:22916324-22916346 TGTCCCCGGGCAGCCAGAGGTGG - Intergenic
1181465225 22:23107283-23107305 GGTCCCAGGCCAGCGACAGATGG - Intronic
1182281068 22:29217945-29217967 GGACCCAGGGCAGCCTGGGGTGG + Intronic
1182576533 22:31276741-31276763 GCCCCCAGGCCAGGCAGTGGCGG + Intronic
1183317297 22:37143716-37143738 GCACCCACACCTGCCAGAGGAGG + Intronic
1183829199 22:40409061-40409083 GGACCCAGCCCAGCATCAGGGGG + Intronic
1184120131 22:42444642-42444664 GGACCCAGGCCATCAGGAGCGGG - Intergenic
1184301254 22:43562544-43562566 GGAGGCAGCCCAGTCAGAGGTGG + Intronic
1203281724 22_KI270734v1_random:135172-135194 AGACCCAGGGCAGCTGGAGGAGG - Intergenic
949793417 3:7818782-7818804 GTGCTCACGCCAGCCAGAGGAGG + Intergenic
950079169 3:10208979-10209001 GGAACCAGCCCATGCAGAGGTGG - Intronic
950170836 3:10838132-10838154 GGTCCCAGCCCAGCCTGGGGTGG - Intronic
950676793 3:14558917-14558939 TGACCCAGGACAGCCGTAGGTGG - Intergenic
950881415 3:16325753-16325775 GGATCCTGGTGAGCCAGAGGAGG + Intronic
951469804 3:23044144-23044166 GATCCCAAGCCAGCCAGGGGTGG + Intergenic
951537280 3:23751385-23751407 GAGCACAGGCCTGCCAGAGGAGG - Intergenic
954659958 3:52221753-52221775 GAAGCCAGGCCAGGCACAGGTGG + Exonic
957088587 3:75706514-75706536 GGCCCCAGGCCTCACAGAGGAGG + Intergenic
957434987 3:80163188-80163210 GGACCCTGGGGACCCAGAGGTGG - Intergenic
960962721 3:123083406-123083428 GGTCTCAGCCCAGCCAGCGGGGG + Intronic
961469888 3:127105068-127105090 GGACCCAGGACAGGAAAAGGTGG - Intergenic
961604116 3:128081195-128081217 GGACCCAGGCCAGGCACACCTGG + Exonic
965621323 3:170644845-170644867 GGAAACAGGCCAGCCAGAGAGGG + Intronic
966769929 3:183494577-183494599 GGACCCAAGCCAGCCTGGGTGGG + Intronic
967406679 3:189123892-189123914 AGACCCTGGCCAGCCAGCCGTGG + Intronic
968469004 4:769107-769129 GGACCCAGGCAGGACTGAGGTGG - Exonic
968707949 4:2092060-2092082 GGACCCAGCCCAGGGAGAGTTGG - Intronic
968891428 4:3371283-3371305 TGCCCCAAGACAGCCAGAGGCGG - Intronic
968902000 4:3436290-3436312 GGAGCGAGGGGAGCCAGAGGCGG - Intronic
968913497 4:3487209-3487231 GGCCTCAGGCCACCCGGAGGTGG + Intronic
969491644 4:7502568-7502590 GGAGCCAGGACATCAAGAGGAGG - Intronic
969713829 4:8859062-8859084 GGCCCCAGGAGAGGCAGAGGTGG - Intronic
970036022 4:11737009-11737031 GGAACCAGGCAACCCAGAAGAGG - Intergenic
970296473 4:14636223-14636245 ACACCCAGGGCAGCCAAAGGCGG + Intergenic
980606558 4:135098878-135098900 GGACCCAGGCCAGTTACAGAGGG - Intergenic
981577694 4:146222544-146222566 GGCCCCAGCCCAGCCTGTGGGGG + Intergenic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
985524525 5:395220-395242 GGACGCAGGGCAGCCAGTGTCGG - Intronic
985772046 5:1817832-1817854 GGAGCCAGGCCAGCCCCTGGGGG + Intergenic
985857269 5:2439352-2439374 GGACACAGGTCAGCAAGATGAGG - Intergenic
987424363 5:17756155-17756177 GGACAGAAGCCATCCAGAGGAGG - Intergenic
994413375 5:99437909-99437931 AGAGCCAGGACACCCAGAGGAGG + Intergenic
997529612 5:134573802-134573824 GGACCCAGCCCCGCAAGAGAGGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998129255 5:139643124-139643146 GGGCCCAGGGCACCCAGCGGCGG + Intergenic
999397494 5:151239373-151239395 GGACACACGCCGGCCAGATGTGG - Intronic
999799392 5:155019437-155019459 GGCCAGAGGACAGCCAGAGGAGG - Intergenic
1000836100 5:166156088-166156110 GGAACCAGGTCTGCCAGAGCAGG + Intergenic
1001038296 5:168314065-168314087 GGATGAGGGCCAGCCAGAGGTGG + Intronic
1002579204 5:180197358-180197380 GGACCCAGGCTGGACAGAGAAGG + Intronic
1003488128 6:6597158-6597180 AGACCCAGGCCCGCAGGAGGGGG + Intronic
1003595509 6:7470823-7470845 GCATCCAAGCCAGCCAGGGGTGG - Intergenic
1004138322 6:12990326-12990348 GGCCCAAGGCCAACCACAGGTGG - Intronic
1007397233 6:41584922-41584944 GGAGCCAGGCCAGGCAGAGGAGG - Intronic
1007713356 6:43838683-43838705 AGGCCCAGGGCAGCCAGAAGAGG + Intergenic
1007728917 6:43933848-43933870 AGACTCAGGACAGCCAGAGGGGG - Intergenic
1007755400 6:44096081-44096103 GGACCCAGGCCAAACTGTGGAGG - Intergenic
1007826695 6:44606151-44606173 GGACAGAGGGCAGGCAGAGGAGG + Intergenic
1008665404 6:53710935-53710957 GGAGTCTGGCCAGCCAGTGGTGG + Intergenic
1013012379 6:106132381-106132403 GGAACCGGGCCAGCCTGACGAGG + Intergenic
1013634299 6:112014338-112014360 TGACCCATTTCAGCCAGAGGAGG - Intergenic
1018443918 6:163837737-163837759 GGACCCAGGCTGGCCAAAGCTGG - Intergenic
1019519861 7:1455681-1455703 GGCGCCAGGCCAGCCAGGTGGGG - Intronic
1020261500 7:6532912-6532934 TGACCCAGGGCAGCATGAGGTGG + Intronic
1021674202 7:23064144-23064166 GGAGGCAGGGCAGCCTGAGGGGG - Intergenic
1023870549 7:44261024-44261046 GGACAGAAGCCAGCCAGAGAGGG - Intronic
1024061561 7:45702598-45702620 GGACCCAGCACAGCCCTAGGAGG - Intronic
1025020254 7:55474891-55474913 GGAGCCAGGGCAGCAAGGGGTGG + Intronic
1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG + Intergenic
1026232278 7:68495899-68495921 GGACCCAGGAAAGTCAGAGATGG - Intergenic
1026892104 7:73988339-73988361 GGACCCAGGGCAGAGACAGGCGG - Intergenic
1027769833 7:82392577-82392599 GGCCCCAGGCCTGCCACAGGAGG - Intronic
1029113320 7:98224215-98224237 GGAGCCAGGACAGCCTGAGCTGG - Intronic
1029424327 7:100486838-100486860 GGGCCCAGCCGAGCCAGCGGGGG - Exonic
1030033102 7:105387568-105387590 GGACCAAGGCCAACGAGAAGGGG + Intronic
1032537699 7:132678326-132678348 GGAGCCAGGTCTGGCAGAGGAGG - Intronic
1032710697 7:134458349-134458371 AGACCCAGGGCACCCCGAGGCGG + Intronic
1032977450 7:137241908-137241930 AGTCCCAGGCCAGCCTGTGGTGG + Intronic
1033450053 7:141454486-141454508 AGACCCAGGCCAGCTTCAGGAGG + Intronic
1034285244 7:149879660-149879682 GGACTCAGCCCATCCTGAGGAGG + Exonic
1034501484 7:151453533-151453555 GGTCCCACACCAGCCAGGGGCGG + Intergenic
1034882501 7:154773207-154773229 GGCCCCAGGCCTGCCTCAGGGGG + Intronic
1034940759 7:155228701-155228723 GCACCTAGGCCAGCCAAGGGGGG + Intergenic
1034973063 7:155431260-155431282 GAGCCCAGGACAACCAGAGGAGG + Intergenic
1035430307 7:158815214-158815236 GGAGACAGGCAAGCGAGAGGCGG - Intronic
1036007803 8:4686879-4686901 GGCCCAAGACCAGACAGAGGTGG + Intronic
1036567231 8:9948006-9948028 GGAACCCGGCGAGTCAGAGGTGG + Intergenic
1036755340 8:11467459-11467481 GGGCCCAGGCCAGACACTGGAGG + Intronic
1036783001 8:11662889-11662911 GGAGCCAGGCCACCCGGAGCTGG - Intergenic
1036786732 8:11692811-11692833 GGCGCCAGGCCGGGCAGAGGCGG + Intronic
1037646692 8:20798979-20799001 GGACACAGGGCAGGCAGAGGTGG - Intergenic
1038060785 8:23909239-23909261 AAATCGAGGCCAGCCAGAGGAGG + Intergenic
1041502745 8:58556381-58556403 GGAACCAGGCCACCCACAGCAGG - Intronic
1043428884 8:80175271-80175293 GGACCCAGGGCGCCCAGTGGAGG + Intronic
1043447246 8:80331094-80331116 TGACCCAGGACAGCCACACGGGG + Intergenic
1044745516 8:95366977-95366999 GGACCCAGGCCAGCCATTGTAGG - Intergenic
1044944158 8:97375321-97375343 GGACCAAGGCCAGCCACACTGGG + Intergenic
1046690896 8:117283027-117283049 GGCCCCAGGCCTGCCACAGGAGG - Intergenic
1046725730 8:117671629-117671651 GGACCCAGGTCAGGAAGATGTGG - Intergenic
1048513242 8:135081031-135081053 GGAACCAGGCCAGGGAGAGAAGG - Intergenic
1048795399 8:138144964-138144986 ATAACCAGGCCAGTCAGAGGAGG - Intronic
1049048079 8:140168746-140168768 GGGGCCAGGCCATCCAGATGTGG + Intronic
1049213958 8:141399259-141399281 AGGACCAGGCGAGCCAGAGGAGG - Intronic
1049271025 8:141696384-141696406 GGGGCCGGGCCTGCCAGAGGGGG - Intergenic
1049404225 8:142444480-142444502 GCACCCAGGCCAGGCAGCGTGGG - Intergenic
1049540973 8:143208817-143208839 GGACCCAGTACGGCCATAGGGGG + Intergenic
1049598556 8:143496445-143496467 GGACGCAGGCCAGCCTCAAGCGG + Intronic
1049671987 8:143873972-143873994 AGATCCAGGACAGGCAGAGGAGG - Intronic
1049718495 8:144104803-144104825 CGACCCAGCCCAGCCAGACCCGG + Exonic
1049935227 9:495249-495271 TGACAAAGGACAGCCAGAGGAGG - Intronic
1050450370 9:5774180-5774202 GGACACAGCCCAAGCAGAGGAGG + Exonic
1056192272 9:84196002-84196024 GGAACCAGGAAAGCCAGTGGCGG - Intergenic
1057907917 9:98996632-98996654 AATCCCAGGTCAGCCAGAGGAGG - Intronic
1060544123 9:124450489-124450511 GGCGCCAGGCCAGCCATAGCGGG + Intergenic
1061254440 9:129446028-129446050 GGACACAGGCGAGCCAGGGAGGG - Intergenic
1061268482 9:129522575-129522597 GGCCCCTGGCCAGCAGGAGGTGG - Intergenic
1062275328 9:135727721-135727743 GAATCCAGGCCAGCGAGTGGGGG - Intronic
1062601564 9:137320720-137320742 GGACCCAGGCCAGGCATGGAGGG - Intronic
1062609784 9:137368785-137368807 GGACCCTGGCCAGACAGTAGAGG - Intronic
1189205909 X:39238614-39238636 GGAGCCAGGCCAGCCAAGTGAGG - Intergenic
1190105042 X:47553896-47553918 GTACCCAGGTCAGCCAGTGCTGG - Intergenic
1191718049 X:64206236-64206258 GCCGCCAGGCCACCCAGAGGAGG + Intergenic
1196461371 X:115935395-115935417 GGAACCAGGTCAACCACAGGGGG - Intergenic
1198277796 X:135112826-135112848 GCACCCAGGCCAGGCAGCTGAGG + Intergenic
1200088969 X:153625594-153625616 GCAGCCAGGCCAGCCAGACTGGG - Intergenic
1200253125 X:154564337-154564359 TGGCCCTGCCCAGCCAGAGGAGG + Exonic
1200264642 X:154640078-154640100 TGGCCCTGCCCAGCCAGAGGAGG - Intergenic
1201074820 Y:10178997-10179019 GGGCAAAGGCCAGCCAGAGGAGG - Intergenic
1201433596 Y:13931610-13931632 TGGCCCAGGAAAGCCAGAGGAGG + Intergenic
1201762513 Y:17555509-17555531 TGACCCAGGGCAGCCAGTGGTGG + Intergenic
1201839039 Y:18350479-18350501 TGACCCAGGGCAGCCAGTGGTGG - Intergenic