ID: 900306377

View in Genome Browser
Species Human (GRCh38)
Location 1:2010874-2010896
Sequence CAGCCAAGGAGGGTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900306377_900306385 -6 Left 900306377 1:2010874-2010896 CCTGTCCCCACCCTCCTTGGCTG No data
Right 900306385 1:2010891-2010913 TGGCTGCCAGACTGGTAACGAGG No data
900306377_900306387 -4 Left 900306377 1:2010874-2010896 CCTGTCCCCACCCTCCTTGGCTG No data
Right 900306387 1:2010893-2010915 GCTGCCAGACTGGTAACGAGGGG No data
900306377_900306386 -5 Left 900306377 1:2010874-2010896 CCTGTCCCCACCCTCCTTGGCTG No data
Right 900306386 1:2010892-2010914 GGCTGCCAGACTGGTAACGAGGG No data
900306377_900306389 17 Left 900306377 1:2010874-2010896 CCTGTCCCCACCCTCCTTGGCTG No data
Right 900306389 1:2010914-2010936 GGTGAGCTGCAACATAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900306377 Original CRISPR CAGCCAAGGAGGGTGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr