ID: 900308340

View in Genome Browser
Species Human (GRCh38)
Location 1:2021760-2021782
Sequence CGCCTTGGTAACTGCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900308333_900308340 17 Left 900308333 1:2021720-2021742 CCGTGCCAGCTCGCGGTGCGCTG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 900308340 1:2021760-2021782 CGCCTTGGTAACTGCAATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 49
900308332_900308340 21 Left 900308332 1:2021716-2021738 CCTACCGTGCCAGCTCGCGGTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 900308340 1:2021760-2021782 CGCCTTGGTAACTGCAATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 49
900308336_900308340 12 Left 900308336 1:2021725-2021747 CCAGCTCGCGGTGCGCTGGTGGC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 900308340 1:2021760-2021782 CGCCTTGGTAACTGCAATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900308340 Original CRISPR CGCCTTGGTAACTGCAATGC TGG Intronic
900308340 1:2021760-2021782 CGCCTTGGTAACTGCAATGCTGG + Intronic
904207605 1:28864943-28864965 AGCTTTTGTAACTGCAATGCCGG + Intergenic
911567201 1:99476196-99476218 TCACTTGGTAACTGCAATTCAGG - Intergenic
915043732 1:152992539-152992561 CGCCTTGGCCACTGAAGTGCTGG + Intergenic
915607324 1:156960866-156960888 CACCATGCTAACTGCAAGGCTGG - Intronic
917188037 1:172383591-172383613 CTCCTTGGTAACTGAACTGTAGG + Intronic
1075661761 10:124201961-124201983 ATCCTTGGTAACTGCAAGGTGGG - Intergenic
1085324944 11:75599461-75599483 TGCCTGGGTGACTGCAATGTAGG - Intronic
1091012028 11:132010298-132010320 CACCTTGGTAACTCCGATGGTGG + Intronic
1102069232 12:110003631-110003653 TGCCTTGGTACCTGGCATGCAGG - Intronic
1104714286 12:131006209-131006231 CCACTTGGGAACTGCAAGGCTGG + Intronic
1136155868 16:28381681-28381703 CGCCATAGTAACTGGAATTCAGG + Intronic
1136207217 16:28733608-28733630 CGCCATAGTAACTGGAATTCAGG - Intronic
1152134603 17:78496495-78496517 CCCCATGGTGACAGCAATGCTGG - Intronic
1152918412 17:83053109-83053131 AGCCTTGGGAACTGCAGGGCTGG + Intergenic
1154241736 18:12658554-12658576 CGCCTAGGGAACGTCAATGCGGG - Exonic
1160538797 18:79609560-79609582 GGCATTGGTGACTGCAAAGCAGG + Intergenic
1161104412 19:2436445-2436467 CGCCTTGCTGACTGCAAAGGTGG - Intronic
926382086 2:12301085-12301107 AGCCTTTGTAACTCCAAAGCCGG - Intergenic
929478323 2:42276736-42276758 CGCTTTGTTAACTGCAAGACTGG - Intronic
929729542 2:44472948-44472970 CACGCTGGTAACTGAAATGCTGG - Intronic
932189140 2:69724375-69724397 CGACTTGGTAAATGGAATACTGG - Intronic
935933529 2:108155821-108155843 CTCCTTACTCACTGCAATGCTGG + Intergenic
945544002 2:211126307-211126329 TGGTTTGGTAGCTGCAATGCTGG + Intergenic
949059589 2:241949269-241949291 CACCATGGTCACTGCCATGCAGG - Intergenic
1172149718 20:32781108-32781130 CCCCTTGGTAACTTCAGTGTTGG + Intronic
1173503742 20:43571454-43571476 CCCACTGGTAACTACAATGCAGG - Intronic
1173968011 20:47128353-47128375 CTCTCTGATAACTGCAATGCTGG - Intronic
1175643845 20:60654414-60654436 CTCTCTGGTAACTGCCATGCTGG - Intergenic
1183783019 22:40010806-40010828 AGCCCTGGAAACTGCATTGCTGG + Intronic
966807611 3:183819160-183819182 CTCCTTGGCAGCTGCAAAGCTGG + Intronic
969489011 4:7488236-7488258 TGCCTTGGCAACTGCAAAACAGG - Intronic
974475789 4:62378327-62378349 CCCCATGGTAAATGCAATGTAGG + Intergenic
974840132 4:67289783-67289805 CACCATGTTAAGTGCAATGCTGG + Intergenic
975657692 4:76658061-76658083 CACTTTGGTAACTACAAAGCAGG - Intronic
983249357 4:165327358-165327380 CGCCTTGGCAACTGCGGTCCCGG - Intergenic
994189679 5:96855907-96855929 AGCCTTGTTAACTGCAATGTTGG + Intronic
1002452743 5:179328482-179328504 CGCCTTGAGGACAGCAATGCTGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1027306383 7:76902157-76902179 CGGCTTGGCAACTGAAATCCTGG - Intergenic
1029244372 7:99188284-99188306 TGTCTTGGTAAATGCAATCCTGG - Exonic
1036134097 8:6142989-6143011 GCACTTGGTAACTGCAATACTGG - Intergenic
1040747372 8:50661853-50661875 CCCCTTAGTAAGTACAATGCTGG + Intronic
1041519307 8:58737776-58737798 GGCCTTGCTAACTGAGATGCTGG + Intergenic
1049833019 8:144714081-144714103 CGCCTTAGAACTTGCAATGCCGG + Intergenic
1052833546 9:33234140-33234162 CTCCTTGATGACGGCAATGCTGG - Intronic
1053893047 9:42715020-42715042 AGCCTTTGCAACAGCAATGCTGG + Intergenic
1056238864 9:84623411-84623433 CACCTTGGGAACTGCACTCCTGG + Intergenic
1057070170 9:92090810-92090832 CAGCTTGGTTACGGCAATGCTGG - Intronic
1061695933 9:132373460-132373482 CTACTTGGTATCTGCCATGCTGG + Intergenic
1189334718 X:40164056-40164078 AGCCTTATTTACTGCAATGCTGG + Intronic
1198000736 X:132433212-132433234 GGCCATGGCAACTGTAATGCAGG + Intronic