ID: 900308511

View in Genome Browser
Species Human (GRCh38)
Location 1:2022454-2022476
Sequence CCGCCACGAAGCTCACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900308511_900308517 -10 Left 900308511 1:2022454-2022476 CCTCCAGGTGAGCTTCGTGGCGG 0: 1
1: 0
2: 1
3: 7
4: 50
Right 900308517 1:2022467-2022489 TTCGTGGCGGGGGCTGCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900308511 Original CRISPR CCGCCACGAAGCTCACCTGG AGG (reversed) Intronic
900308511 1:2022454-2022476 CCGCCACGAAGCTCACCTGGAGG - Intronic
900591777 1:3463393-3463415 CCGCCCCGAAGCTCTGGTGGCGG - Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
908154472 1:61338287-61338309 CTGCCACAAAGCTCAGCTGCCGG + Intronic
917390395 1:174530056-174530078 CCGTCAGGATGCTCAGCTGGTGG + Intronic
921119579 1:212125127-212125149 CCGCCAGGAAGCCCAGCTGTGGG - Intergenic
1067266580 10:44750750-44750772 GCACCACGAAGATCACCTTGTGG - Intergenic
1081810442 11:45911160-45911182 CCACCCCGAAGCTGAGCTGGTGG - Intronic
1089742953 11:120597488-120597510 CTGCCACGGGGCTCAGCTGGGGG - Intronic
1096560565 12:52433237-52433259 GCTCCAAGAACCTCACCTGGAGG + Exonic
1099183289 12:79491893-79491915 CCTCCACCAAGATCACCTGTTGG + Intergenic
1102250723 12:111385588-111385610 CCGCCAGGAGGCTCACCTGGGGG + Intergenic
1108493222 13:51001311-51001333 CTGCCACCAATCTCACCAGGTGG - Intergenic
1108595553 13:51945689-51945711 CCGCCAAGGAGCCCACCAGGGGG - Intronic
1111672374 13:91347813-91347835 CCTCCGCGAAGCTCTCCTCGCGG + Intergenic
1113792345 13:113035602-113035624 CGGCCACGAAGCTGTCCTGGGGG - Intronic
1128324076 15:66712269-66712291 ACTCCACTAAGCTCACCTAGGGG - Intronic
1129761448 15:78131352-78131374 CCGCCCCGCAGCTCGCCTGGAGG + Exonic
1130097929 15:80870107-80870129 CAGCCATGCAGCTCACATGGAGG - Intronic
1133813484 16:9178884-9178906 CCTCCAGGAAGGGCACCTGGAGG - Intergenic
1134685395 16:16154857-16154879 CCTCCACCAGCCTCACCTGGGGG + Exonic
1138010224 16:53372737-53372759 ACGCCTAGAAGCTCCCCTGGAGG - Intergenic
1141951915 16:87344977-87344999 CTGCCCCGAACCCCACCTGGGGG + Intronic
1142670603 17:1485888-1485910 CCTCCACCAACCCCACCTGGAGG - Intronic
1144862815 17:18316125-18316147 CCTCCACGAAGTTCAGCTTGGGG - Exonic
1147317899 17:39629556-39629578 GCCCCAGGAAACTCACCTGGTGG - Exonic
1151411134 17:73930553-73930575 CCCCCACAGCGCTCACCTGGTGG - Intergenic
1158314957 18:56201686-56201708 CCTCCATGAAGCTGGCCTGGAGG - Intergenic
1163469130 19:17486755-17486777 CCGGCGCGAAGCCCAGCTGGCGG - Exonic
1168161448 19:54513035-54513057 CCGCCCCCAAGCCCACCTGGAGG + Intergenic
930949850 2:57127198-57127220 ACGGGAGGAAGCTCACCTGGAGG - Intergenic
931748945 2:65314130-65314152 CGTCCGGGAAGCTCACCTGGCGG + Exonic
937319974 2:120955318-120955340 CTGCCACGAGGGTCATCTGGTGG - Exonic
943725098 2:191245205-191245227 CCGCCGCGACGCTCACCGGGGGG + Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1171412337 20:24955979-24956001 CAGCCATGAAGCTCACCTTCTGG + Intronic
1176070532 20:63223977-63223999 CAGCCATCAGGCTCACCTGGAGG - Intergenic
1179501990 21:41815870-41815892 CCCCCACGCAGCCCACCTGGGGG + Intronic
1182241320 22:28918631-28918653 CAGCCACCAAGCTTGCCTGGTGG + Intronic
1185365853 22:50436389-50436411 CCTCCACGAAGCTCTCCCAGCGG - Exonic
1185367422 22:50443317-50443339 GCGCGAGGAAGCTCACCTGCAGG - Intronic
954807576 3:53229421-53229443 CCACCGCGATGCTCACCTGGGGG + Exonic
960575626 3:119226793-119226815 CTGCCCCCACGCTCACCTGGTGG + Exonic
962263324 3:133928475-133928497 CCCCCACCTTGCTCACCTGGGGG - Exonic
984298637 4:177886758-177886780 CAGCCACACAGCTGACCTGGTGG + Intronic
984583358 4:181535223-181535245 CTCCCAGGAAGGTCACCTGGTGG - Intergenic
1005570450 6:27140023-27140045 CCACCACGAAGTTTTCCTGGAGG - Intergenic
1006514511 6:34538520-34538542 TCGCCACGAGGCTGACCTGGTGG - Intronic
1016986745 6:149901013-149901035 CTGCCACGCAGTTCCCCTGGCGG + Intergenic
1017787001 6:157764680-157764702 CCGGCATGGAGCTCGCCTGGAGG + Intronic
1018765765 6:166931838-166931860 CTTCCACGAAGCTCTCCTGTGGG + Intronic
1020139660 7:5605544-5605566 CCGCCCTGGAGCCCACCTGGCGG - Exonic
1023959311 7:44913234-44913256 CCACCACCAAGCTCACCACGTGG + Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1034343618 7:150372645-150372667 CCGCCACAAACCCTACCTGGCGG + Exonic
1034427371 7:151021172-151021194 CAGCCACCCAGCTCACCGGGGGG + Exonic
1036396944 8:8377856-8377878 CCTCCGGGAAGCTCACCGGGTGG + Exonic
1059708161 9:116842870-116842892 CTGCCAGGGAGCTCTCCTGGGGG - Intronic
1060017418 9:120098721-120098743 CCGCCCCCATGCTCCCCTGGAGG - Intergenic