ID: 900308583

View in Genome Browser
Species Human (GRCh38)
Location 1:2022766-2022788
Sequence TCCCGTGGGCGCGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900308562_900308583 25 Left 900308562 1:2022718-2022740 CCAAAGTGCCTGCTCCTCCTTAG 0: 1
1: 0
2: 0
3: 33
4: 217
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308569_900308583 2 Left 900308569 1:2022741-2022763 CCCTGTGCCGGGCCACTCCTGGG 0: 1
1: 0
2: 2
3: 16
4: 212
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308577_900308583 -10 Left 900308577 1:2022753-2022775 CCACTCCTGGGGGTCCCGTGGGC 0: 1
1: 0
2: 0
3: 18
4: 227
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308566_900308583 11 Left 900308566 1:2022732-2022754 CCTCCTTAGCCCTGTGCCGGGCC 0: 1
1: 0
2: 2
3: 18
4: 145
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308574_900308583 -5 Left 900308574 1:2022748-2022770 CCGGGCCACTCCTGGGGGTCCCG 0: 1
1: 0
2: 2
3: 20
4: 252
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308567_900308583 8 Left 900308567 1:2022735-2022757 CCTTAGCCCTGTGCCGGGCCACT 0: 1
1: 0
2: 1
3: 16
4: 148
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308571_900308583 1 Left 900308571 1:2022742-2022764 CCTGTGCCGGGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 173
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107
900308563_900308583 17 Left 900308563 1:2022726-2022748 CCTGCTCCTCCTTAGCCCTGTGC 0: 1
1: 0
2: 2
3: 99
4: 1009
Right 900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900308583 Original CRISPR TCCCGTGGGCGCGGGGTCCT GGG Intronic