ID: 900309716

View in Genome Browser
Species Human (GRCh38)
Location 1:2027855-2027877
Sequence CTGCCTGGGGAGCCGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900309707_900309716 8 Left 900309707 1:2027824-2027846 CCTGGAGCAGTCTGGCTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 200
Right 900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG 0: 1
1: 0
2: 2
3: 52
4: 360
900309704_900309716 16 Left 900309704 1:2027816-2027838 CCAGAAAGCCTGGAGCAGTCTGG 0: 1
1: 1
2: 0
3: 17
4: 182
Right 900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG 0: 1
1: 0
2: 2
3: 52
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900309716 Original CRISPR CTGCCTGGGGAGCCGGGCCA TGG Intronic
900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG + Intronic
900359966 1:2283719-2283741 CTGCCTGGACTTCCGGGCCATGG - Intronic
900475578 1:2874918-2874940 CTGCCTGGGTGGCCCAGCCAGGG - Intergenic
900645939 1:3708788-3708810 CTGCCTGGGCACCCAGGCCATGG + Intronic
900682255 1:3923582-3923604 TTGATTAGGGAGCCGGGCCACGG - Intergenic
901322476 1:8348313-8348335 TTCCCTGGGGAACCGGGACAGGG + Intergenic
902375285 1:16027466-16027488 CTGCCTGGGGGCCGGGGCGAGGG + Intronic
902380247 1:16049276-16049298 CTGCCTGGGGGCCGGGGCGAGGG + Intronic
902875802 1:19340032-19340054 CTGGCTGGGGACTCAGGCCAGGG + Intronic
905169034 1:36099016-36099038 CTGCCTGGGGCCCCAGGGCAGGG - Exonic
905369826 1:37477006-37477028 ATGCCTGCTGAGCTGGGCCAGGG - Intronic
905414168 1:37793605-37793627 CTGCCTGGGGTGCCGGGGAGGGG + Intergenic
905890810 1:41517195-41517217 CTGCCTGGTGGGCTGGACCAGGG - Intronic
910803884 1:91171487-91171509 CTGCTTGGGGAGCCTGGGGATGG - Intergenic
912832690 1:112967707-112967729 CTGCCTGGGGATCCAGACCTGGG + Intergenic
913075119 1:115335742-115335764 CTGCTTGGGGATCTGGGCCTTGG + Intronic
915331901 1:155117863-155117885 CTGCCTGCAGGGACGGGCCAGGG + Intergenic
916173735 1:162021338-162021360 CTGCCTGGGGAGGCTGGCAGGGG - Intronic
917704049 1:177613354-177613376 CTGTCTGGGGAAGCTGGCCAGGG - Intergenic
919810025 1:201403159-201403181 ATGCTTGGGGAGCCAGGGCATGG - Intergenic
920166753 1:204041525-204041547 CCTCCTGGGGACCTGGGCCAGGG + Intergenic
920370677 1:205477527-205477549 CTCCCAGGAGACCCGGGCCAAGG - Intergenic
920967469 1:210712948-210712970 GTGTCAGGGGAGCCAGGCCAAGG - Intronic
922168481 1:223135361-223135383 CTGCCTGGGCAGGCTGCCCAGGG + Intronic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
922720066 1:227895851-227895873 AGGCCTGGGGTGCCGGGCCCCGG - Intergenic
922766520 1:228159084-228159106 CTGGCTTGCGAGCTGGGCCAGGG + Exonic
922790032 1:228306259-228306281 CTGCCTGTGGAGCCAGGCCAGGG + Intronic
923490435 1:234479027-234479049 CTGCTTGGGGCGCTGTGCCAAGG - Exonic
923624261 1:235601344-235601366 CTGCCTGGTGAGGGGCGCCATGG + Intronic
924563889 1:245179966-245179988 GCGCCTGGGGGGCCTGGCCAGGG + Intronic
924708791 1:246518233-246518255 ATGCTTGGGGAGCTGGTCCAGGG - Intergenic
1062966659 10:1612327-1612349 CTGGCTGGGGAGGGCGGCCATGG - Intronic
1063075397 10:2711433-2711455 CTGCCTCTGGAGCCTGCCCAAGG + Intergenic
1063426809 10:5956709-5956731 GTGCCTGGGGTGACGGGGCAGGG + Intronic
1063904023 10:10764901-10764923 CTTTCTGGGGAGCCTGGCCAAGG - Intergenic
1064027571 10:11860729-11860751 CTGCGTGGGGATCCGAGCAAGGG + Intronic
1064441136 10:15354568-15354590 ACGCCTGGGGAGCCAGGCCCGGG + Intronic
1065533637 10:26697772-26697794 CGGCCGGGGGAGCCGGGCCCGGG - Exonic
1067498030 10:46776154-46776176 CTTCCTGGGGAGCCGGTCCCCGG + Intergenic
1067596616 10:47564260-47564282 CTTCCTGGGGAGCCGGTCCCCGG - Intergenic
1069825117 10:71250167-71250189 CATCCTGGGGAGCAGGGCCTGGG - Intronic
1069861244 10:71473030-71473052 CTGGCTGGGGAGCAGGGACTGGG + Intronic
1070230342 10:74559210-74559232 ATGCCTGGGCAGCTGGGCCAAGG - Intronic
1070620641 10:78007718-78007740 CAGCCTGGCGAGCCGTGACATGG + Exonic
1070771964 10:79087859-79087881 GTGCCTGGGGAACCGGGGCAAGG - Intronic
1070801480 10:79246810-79246832 CTGCCTGTGGTGTCTGGCCAGGG - Intronic
1072617624 10:97060047-97060069 CTTCCTGGGGAGCTGGTACAGGG - Intronic
1072682442 10:97516940-97516962 CTGACTGCGGGGCAGGGCCATGG + Intronic
1073403410 10:103276962-103276984 CGACCTGGGGCGCCGGGACAGGG - Intergenic
1073469912 10:103716117-103716139 CTGCCAGGGAAGGAGGGCCAGGG - Intronic
1074460940 10:113636248-113636270 CTGCCAGAGGAGGCTGGCCAAGG - Intronic
1074705519 10:116126445-116126467 GTGCCTGGGCAGGCAGGCCAAGG + Intronic
1076113566 10:127879890-127879912 CCGCCAGGGGATCCTGGCCACGG + Intronic
1076293977 10:129369728-129369750 CTGCCTGAGGAGCCCGGGCCTGG - Intergenic
1076723908 10:132404695-132404717 CCTCCTCGGGAGCCCGGCCATGG - Exonic
1077341904 11:2029989-2030011 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1077376962 11:2209622-2209644 CCCCCTGGGAAGCAGGGCCAGGG - Intergenic
1077481072 11:2814911-2814933 CTGCCTCTGGAGCCTGGCCTGGG + Intronic
1080867880 11:36211657-36211679 CTGCCTGGGGTCCCTGGCCCAGG + Intronic
1081627840 11:44666182-44666204 CTGCCAGCAGAGCCGGGCCAGGG - Intergenic
1082091620 11:48094958-48094980 TGGCCAAGGGAGCCGGGCCATGG + Intronic
1082659486 11:55893559-55893581 CTGTCTGGGGTGGGGGGCCAGGG - Intergenic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1083610227 11:64000805-64000827 CCGCCTGGGGAGGTGGGCCTTGG - Intronic
1083691138 11:64409628-64409650 GGGCCTGCGCAGCCGGGCCAAGG + Intergenic
1083720723 11:64602270-64602292 CTGTGTGGGGAGCTGGGACATGG - Exonic
1084278935 11:68073707-68073729 CTGGCTGGGGACCAGGGGCAGGG - Intronic
1084357953 11:68652085-68652107 CTGCCTAGGGGGCTGTGCCAGGG + Intergenic
1084419016 11:69050985-69051007 CTTGCTGGGGACCCTGGCCAAGG - Intronic
1084430183 11:69106663-69106685 CTCACTGGGCAGCCGGGCCTGGG - Intergenic
1084664766 11:70570468-70570490 CTCCCTGGGGAGCCTGGCAGTGG - Intronic
1084677670 11:70645734-70645756 CAGACTGGGGAGCTGGGGCAAGG + Intronic
1085884974 11:80511076-80511098 CTGCCTGGGGTGGGGGGCTAGGG + Intergenic
1089591761 11:119546382-119546404 CTGCCAGGGGGGCATGGCCAGGG + Intergenic
1090252656 11:125262578-125262600 CTGCTTGGGGAGCAGGGCAAAGG - Intronic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1090492741 11:127179563-127179585 CTGCCTGAGTAGCCTGGGCATGG + Intergenic
1091235302 11:134018177-134018199 CAGCCTGGCGAGCAGAGCCAGGG + Intergenic
1091284758 11:134402443-134402465 CATCCTGGGGAGACGGGGCAGGG - Intronic
1202824890 11_KI270721v1_random:85178-85200 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1091545177 12:1496765-1496787 CTGCCAGGGGAGACGTGCCCGGG + Intergenic
1092165565 12:6340566-6340588 CTGCCTGGGGACCTGGGGCCGGG + Intronic
1094052798 12:26239222-26239244 ATGCTTAGGGAGCCGGGCCCTGG - Intronic
1096519047 12:52173914-52173936 CTGGCTGGGGAGACGTGGCAGGG - Intronic
1097237500 12:57550111-57550133 AAGCCTGGGGAGCAGGGCCGGGG - Exonic
1098925718 12:76348116-76348138 CTGCCTGGGGTGCCCGGCTACGG + Intronic
1099202143 12:79690115-79690137 CTCCCGGGGGGGCCGGGCCCGGG + Exonic
1101379405 12:104201487-104201509 CTGTCTGGGGAGGCTGGCTAGGG + Intergenic
1102034174 12:109761492-109761514 CTGCCTGGGGAAGAGGGCCCGGG - Intronic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1102869802 12:116405004-116405026 CAGATTGGGGACCCGGGCCAAGG + Intergenic
1102932954 12:116876541-116876563 CTGCCTTGGGAGCAGGGGAAGGG - Intronic
1102932966 12:116876576-116876598 CTGCCTGGGAGTCGGGGCCAGGG - Intronic
1103009929 12:117450245-117450267 CTGCCTGGGTAGCAGGGACAAGG - Intronic
1103703147 12:122858350-122858372 CTACCTGGTGAGCAGGGCCCAGG + Exonic
1103971775 12:124677213-124677235 GTGCCTGGGGAGCAGGGGCTTGG - Intergenic
1104814492 12:131637889-131637911 GTGCCTGGGAAGCAGGGCCTGGG + Intergenic
1106115210 13:26811847-26811869 CAGCCTGGGAAGAGGGGCCACGG - Intergenic
1106776739 13:33016531-33016553 CTGCGTGCGGAGCCGGGCGACGG + Exonic
1108532754 13:51343019-51343041 TTGGCTGGGGACCCTGGCCAGGG + Intronic
1108688969 13:52845992-52846014 CCGCCCGGGGAGCCGGGCCCAGG - Exonic
1108733352 13:53257409-53257431 CAGCATGGGGAGCCAGGCCAGGG + Intergenic
1113441747 13:110334432-110334454 CTGCCTGGGGAGCAGACCCATGG + Intronic
1113481540 13:110625508-110625530 CTGCCTCTGGAGCTGGGCCCCGG - Intronic
1113762549 13:112859608-112859630 GGGCCTGGGGAGGGGGGCCACGG + Intronic
1113805972 13:113110173-113110195 CTGTCGGGGGAGCCGGGCAGGGG + Intronic
1114224234 14:20723554-20723576 CTGCCGGGGCAGCCGGCTCAGGG + Intergenic
1114454696 14:22847107-22847129 CTGCCTGGGCAGCAAGGACAGGG - Exonic
1114477509 14:23007219-23007241 ATGGCTGGGGAGCAGGGTCACGG + Intronic
1114635002 14:24182400-24182422 CAGCCTGTGGAGCCAGGTCAGGG + Exonic
1115850818 14:37588546-37588568 CTGCCTCGGGAGCTGGACCGCGG - Intergenic
1118349817 14:64965742-64965764 CTGTCTGGGGAGCGGGGAGAAGG + Intronic
1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG + Intronic
1119645735 14:76346994-76347016 CTGCCCGCAGAGCCAGGCCAAGG + Intronic
1121235728 14:92390108-92390130 CGGACTGGGAAGCCGGGCCCAGG - Intronic
1122082520 14:99275125-99275147 CTGCCTGGGGTGCTGAGGCAGGG - Intergenic
1122441436 14:101734766-101734788 GGGCCTGGAGAGCCGAGCCAGGG + Intergenic
1122550151 14:102545058-102545080 CCGCCCGGGGAGCCGGGACGCGG - Intergenic
1122659963 14:103288388-103288410 CTGCCTGGAGAACCTGGCGATGG + Intergenic
1122719094 14:103712273-103712295 CTGCCTGGGCAACCAGGCCTGGG - Intronic
1122795999 14:104206525-104206547 CTGCCTGGGGAGCCCCGCGCTGG - Intergenic
1122814881 14:104307456-104307478 CACCCTGGGGAGCCTGGTCACGG - Intergenic
1125490786 15:40147105-40147127 CTGCCTGGGGTGGAGGGTCAGGG + Intergenic
1127377460 15:58398146-58398168 CTGCCTGGGGAGGCTGGAGAGGG - Intronic
1128452252 15:67812302-67812324 CTGCAGGGGGAGCCAGGCCAGGG + Intergenic
1129082189 15:73051735-73051757 CTCCCACGGGAGCCGCGCCAGGG + Exonic
1129268925 15:74409467-74409489 CTGCCTGGAGAGCTCGGCCCAGG + Exonic
1130728005 15:86461076-86461098 CTCCCTGAGGAGCTGAGCCAAGG - Intronic
1132222967 15:100118632-100118654 CTGCCTGGGGAGGCTGTCCGAGG - Intronic
1132362909 15:101232978-101233000 CTGCCTTGGGAGGTGGGTCAGGG - Intronic
1132594369 16:741452-741474 CTTCCTGGGGAGCCGCTCCCAGG + Intronic
1132617245 16:847811-847833 TTGCCTGGGCCGCCTGGCCAGGG - Intergenic
1132620914 16:867921-867943 CTGCCTGGAGACCCCAGCCAAGG - Intronic
1132978029 16:2720171-2720193 CTGGCTGGGGCGCAGGGCCGTGG + Exonic
1134070259 16:11256063-11256085 CCGCCAGGTGAGCCGGGCCCTGG - Exonic
1136610436 16:31362391-31362413 CTGCCTGGGGTGGGGGTCCAGGG + Intronic
1136618064 16:31410663-31410685 CTGCCTGGGGTGGGGGTCCAGGG + Intronic
1136933442 16:34437637-34437659 CTGCCTGGGGAGCGGGGCTGCGG + Intergenic
1136971130 16:34974177-34974199 CTGCCTGGGGAGCGGGGCTGCGG - Intergenic
1137449226 16:48555283-48555305 CTGCCTGGGTTGCAGAGCCAGGG + Intronic
1137738442 16:50742173-50742195 CGGGCTGGGGAGCCGGGGCGAGG + Intronic
1138546235 16:57721567-57721589 CTGCCTGCAGAGCCAAGCCAAGG - Intronic
1139472653 16:67186505-67186527 CTGCCTGGGGAGCAGGGATAGGG + Intronic
1139472728 16:67186881-67186903 TTGCCTGGGGGGAGGGGCCAGGG + Exonic
1139965266 16:70741880-70741902 CTGCTTGGGCGGCAGGGCCAGGG - Intronic
1140475879 16:75239022-75239044 TTGCCTGGGGAGGCAGGCCTGGG - Intronic
1141771199 16:86090635-86090657 CTGCCAGGGCAGCCGGGTCTTGG + Intergenic
1142012919 16:87726254-87726276 CGGCGTGGGGAGACGGGCCGAGG - Intronic
1142259547 16:89036361-89036383 CTGCCCGGGGTGCTGTGCCAAGG + Intergenic
1142638146 17:1270476-1270498 CCGCGTCGCGAGCCGGGCCAAGG + Intergenic
1143562748 17:7705275-7705297 CGGCATGGGGCGCCGGACCAGGG - Exonic
1145012723 17:19378814-19378836 CGGGCTGGGGAGCAGGACCAGGG - Intronic
1145311682 17:21704322-21704344 CCTCCTGGGGGGCCAGGCCACGG + Exonic
1145778592 17:27546643-27546665 GTGCCTGGTGGGCAGGGCCAGGG + Intronic
1147214256 17:38890288-38890310 CCTCCTGTGGGGCCGGGCCAGGG + Intronic
1147466468 17:40614912-40614934 TTCCCGGGGGAGCCAGGCCAAGG - Intergenic
1147871638 17:43591778-43591800 CTGCCTGGGGATCAGGCTCAAGG + Intergenic
1148071554 17:44911592-44911614 ATGCCAGGGGAGAAGGGCCAGGG - Intronic
1148159155 17:45440302-45440324 CTGCCTGGTGAGCAGCGCCAGGG - Intronic
1148441510 17:47713909-47713931 CTGCATGGGGACCCAGGCCAGGG - Intergenic
1148684799 17:49495399-49495421 CTGCCGCGGGAGGCGGGCGATGG + Exonic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1149314574 17:55426734-55426756 CTGCGTGGGGTGCGGGGCAAGGG - Intergenic
1150390502 17:64787387-64787409 CTGCCTGGTGAGCAGCGCCAGGG - Intergenic
1150429307 17:65102470-65102492 GTGCCTGGGGAGGTGGGACAGGG - Intergenic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1151654153 17:75487873-75487895 CTGACTGGGGGGCAGGGCCGTGG + Intronic
1151878405 17:76880364-76880386 CTGGCAGGGGAGCCCAGCCAGGG + Intronic
1152754904 17:82083148-82083170 CTGCCTGGGGACCAGAGCCTGGG + Intronic
1153984934 18:10343480-10343502 CTGCCTGGGGAGGCGGGAATGGG + Intergenic
1155398885 18:25416602-25416624 GTGCATGGGGAGGGGGGCCATGG + Intergenic
1156171145 18:34487507-34487529 CTGCCTGGGAAGCCGAGGCCAGG - Intergenic
1156497657 18:37536680-37536702 CTGCCTGGGGACTGGGGCCAGGG - Intronic
1157668754 18:49510898-49510920 CACCCTGGGGAGCAGGGACAGGG - Intergenic
1158731152 18:60023816-60023838 CTGCCTGAGGAACCAGGGCAGGG + Intergenic
1159022642 18:63155914-63155936 CTGGCTGGGGAGGCGGGGAAGGG - Intronic
1160121578 18:76135066-76135088 CTGCATGGGCAGCGGGGCCCAGG - Intergenic
1160177872 18:76610994-76611016 CTGCCTGGGGTGGCGGGGCCGGG + Intergenic
1160535695 18:79590213-79590235 ATGCCTGGGGACCCGGGCAGTGG + Intergenic
1160554673 18:79717605-79717627 CTGCCTGGAGCGCTGGGACAAGG + Exonic
1160577240 18:79863674-79863696 CCGCCCGGGGAGCAGGGCCATGG - Exonic
1160859955 19:1233563-1233585 GGGCCTGGGGAGGCGGGCCCGGG - Exonic
1161081572 19:2313037-2313059 CTGCCCGGGGGGCGGGGGCAGGG - Intronic
1161118818 19:2513782-2513804 CAGGCTGGGGAGCCGCGGCAGGG - Exonic
1161156165 19:2732843-2732865 CTTCCTGGAGATCCTGGCCAAGG - Exonic
1161171719 19:2815503-2815525 CTCCCTGGGGAACAGGGCCCTGG - Exonic
1161252061 19:3285713-3285735 TTGCCTGAGGGGCGGGGCCATGG - Intronic
1161620135 19:5293261-5293283 CGGCCTGGGGAGCTCGGCCTGGG + Intronic
1161767875 19:6216890-6216912 CTGGCTGGGAAGCTGGGCCTGGG + Intronic
1162013132 19:7830140-7830162 CTGGCTGGTGGGCGGGGCCAGGG + Intergenic
1162019074 19:7860521-7860543 CTGCGTGGGGCCCCAGGCCATGG - Intronic
1162295637 19:9811445-9811467 CTGCTTGTGGAGCCAGGCCATGG + Exonic
1163679314 19:18671518-18671540 CTGGCAGGGGCGCCGGCCCAGGG + Exonic
1163768779 19:19178355-19178377 CAGGCTGGGGAGCAGGGGCAAGG + Intronic
1163846302 19:19640120-19640142 CAGCCTGGGAACCCTGGCCATGG - Exonic
1164938630 19:32233835-32233857 CTGCATGGGCAGCCAGGTCATGG + Intergenic
1165063010 19:33214036-33214058 CTGGCAGGGGAGGAGGGCCATGG - Intronic
1165347719 19:35259221-35259243 CTGCCTGGGGTGCAGGGCACAGG - Intronic
1165828492 19:38719026-38719048 CTGCAGGGGGAGCCAGGCCCGGG - Intronic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167759895 19:51439413-51439435 CAGCCTGGGGAGCAGACCCAAGG - Intergenic
1168670873 19:58240158-58240180 CTGCCAGGGGCACTGGGCCATGG - Intronic
925161114 2:1685140-1685162 CTGCCTGGGGAGCTGGCCCCGGG - Intronic
925763375 2:7208127-7208149 CTAACTGGGGAGCAGGGACAGGG - Intergenic
927156477 2:20224252-20224274 TGGCCCGGGGAGCCGGGCCAGGG - Intronic
927653443 2:24926619-24926641 CTGTCTGGGGATCGGGCCCATGG - Intergenic
927914257 2:26924868-26924890 CTGCCTGGGAAGACGGGAAAAGG - Exonic
929536348 2:42786752-42786774 GGGAGTGGGGAGCCGGGCCAGGG + Intronic
929874350 2:45784213-45784235 CTTCCTTGGGATCCTGGCCAAGG - Intronic
930733354 2:54750147-54750169 CAGGCTGGGCAGCCAGGCCAAGG - Intronic
931216805 2:60252753-60252775 CTGCCTGTGGACCCTGGCCATGG + Intergenic
931256931 2:60581949-60581971 CTTCCTGCGGACCCGGCCCACGG - Intergenic
932015706 2:68024240-68024262 CTGCCTGAGGAGCCAGGCCATGG + Intergenic
932812026 2:74833940-74833962 CAGCCTGGGGAGGCGCGCCGGGG - Intergenic
933713717 2:85345335-85345357 CTCCCTGAGGAGCCGGGGAAGGG - Intronic
937311544 2:120906094-120906116 CTACTTGGGGAGCTGGGCCAGGG + Intronic
939629827 2:144517481-144517503 CGCCCAGGGGAGCCGGGCCAGGG + Intronic
940650358 2:156435649-156435671 CCGCCGGGGGAGCCGGGCGAGGG + Exonic
941111772 2:161424252-161424274 CTGGCTGGGGGTCCGGGCCGCGG - Exonic
941812457 2:169768255-169768277 CGCCCAGGGGAGCCCGGCCAAGG - Intronic
947805686 2:232966431-232966453 CTGCAAGGGGAGGAGGGCCAAGG - Intronic
948464468 2:238145620-238145642 CAGCCTGGGGCACCAGGCCATGG - Intronic
948689635 2:239693885-239693907 CTGCCAGGGCTGCAGGGCCATGG + Intergenic
948794598 2:240395756-240395778 CTGCGGGAGGAGCCAGGCCAGGG + Intergenic
949042825 2:241857434-241857456 GTGCCTGAAGAGCCGGGACACGG + Intronic
1169660841 20:7976554-7976576 CTGCCTGGGATGCCTGGCCTGGG + Intergenic
1170658633 20:18315203-18315225 CAGCCTGGGGATCCGGGCCCAGG + Exonic
1172637364 20:36418958-36418980 CAGCCTGGTGGGCAGGGCCATGG + Intronic
1172977498 20:38918023-38918045 CTCCCTGGGTATCGGGGCCAGGG - Intronic
1175200092 20:57270818-57270840 CTCCCTGGGGAGCACAGCCAAGG + Intergenic
1175215291 20:57389312-57389334 CTGCCGCGGGGGCCGGGCCCAGG - Intergenic
1175268004 20:57714212-57714234 CTGCTTGGGGAGCCGGTTGAGGG + Intergenic
1175691932 20:61071780-61071802 CTGTCTGGGGAACAGGTCCATGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176088317 20:63307952-63307974 AGGCCTGGGGAGCAGGGGCATGG - Exonic
1176268325 20:64222284-64222306 CTGCTTGGTGAGCTTGGCCAGGG - Intronic
1176382179 21:6119069-6119091 CTGCTTGGGGACACGGGCCGGGG - Exonic
1178314834 21:31559120-31559142 CGGCCTCGGGGGCCGGGCCGCGG + Intronic
1178534978 21:33403610-33403632 CCGCCAGGTGAGCCGGGCCTGGG + Exonic
1178901930 21:36605509-36605531 CTGCTTGGGGATGGGGGCCATGG - Intergenic
1179144966 21:38760027-38760049 CTGACTGGAGAGTCTGGCCAGGG - Intergenic
1179741293 21:43419170-43419192 CTGCTTGGGGACACGGGCCGGGG + Exonic
1179965315 21:44801598-44801620 CTGGCGGGGGAGCCGGGCCCGGG - Intronic
1180068349 21:45424009-45424031 CTGCAGACGGAGCCGGGCCAGGG + Intronic
1180087787 21:45515834-45515856 CTGCCTGCGGGGCCGGGGCCTGG + Exonic
1180256849 21:46635602-46635624 CTGCGCGGGGCGCCGGGCCCTGG + Intronic
1180738268 22:18034923-18034945 CTACCAGGGGAGCCCCGCCACGG - Intergenic
1180866899 22:19124837-19124859 CTGCCCTGGGAGCCCAGCCAGGG + Intergenic
1180913365 22:19468981-19469003 GTGCCTGGGAAGCCGTGCCTAGG + Intronic
1180995764 22:19964479-19964501 ATGGGTGGGGAGCTGGGCCAGGG + Intronic
1181027276 22:20133274-20133296 CAGCCTGGGGAGCCTGGCCTGGG + Intronic
1181513473 22:23399100-23399122 CTCCCTGGGTGGCCGGGCCCTGG - Intergenic
1182903908 22:33920604-33920626 CGGCCTGGGGCGCGGGGCCGGGG + Intronic
1183090577 22:35519274-35519296 CTGACTTGAGAGCAGGGCCAGGG + Intergenic
1183950394 22:41349379-41349401 CTGACTGGGGTGACAGGCCAGGG + Intronic
1184255306 22:43283086-43283108 CTGGATGAGGAGCAGGGCCAGGG - Intronic
1184639855 22:45864776-45864798 CTTCCTGGGGAGCAGGGCCGGGG - Intergenic
1184784949 22:46667119-46667141 CTAGCTGGGAAGCCTGGCCAGGG - Intronic
1185058551 22:48593577-48593599 CCACCTGGGGTGCTGGGCCAAGG - Intronic
1185271936 22:49933857-49933879 GGTCCTGGGGAGCCGGGGCAGGG + Intergenic
1185380174 22:50504334-50504356 CAGCCTGGGGAGCAGGGGTAAGG - Exonic
1185380539 22:50505697-50505719 CTGGCTGCTGAGCCTGGCCACGG - Exonic
950386378 3:12663766-12663788 ATGCCGGGGGAGCCGGGCGGCGG - Intronic
952832010 3:37573088-37573110 CTGCCTGTGGAGCCTGGGCCAGG - Intronic
953381857 3:42478124-42478146 CTGTCTGGGGAGTGGGCCCAGGG - Intergenic
954033634 3:47838052-47838074 CTGCTGGGGAAGCCAGGCCAAGG + Intronic
954661715 3:52230117-52230139 CTTCCTGGGGAGAGGGGCCTGGG - Intronic
954695435 3:52422227-52422249 CTGCCTGGGAACTCGAGCCAGGG + Exonic
955953679 3:64267104-64267126 GTGCCTGGGCAGCCGTGCCCTGG - Intronic
961038709 3:123661865-123661887 CTCTCTGGGGAGTCGGGCCAGGG + Intronic
961158311 3:124700045-124700067 CTGCCTGGGGGGCCAGGGCTGGG - Intronic
961373753 3:126448955-126448977 CTGCCTGGGGAGACGGGACGGGG + Intronic
961452562 3:127008996-127009018 CTGCCTGAAGAGCCAGGCCAAGG + Intronic
961497769 3:127306736-127306758 CAGCCTGGGGCGGAGGGCCAGGG - Intergenic
961680834 3:128598930-128598952 CGGCCTGGGGAGCAGGGCTGAGG - Intergenic
961933728 3:130561269-130561291 CTGCCAGGGGAGCCCTGCCGTGG - Intronic
962398030 3:135034680-135034702 GTGCCTGGGGTGCCCTGCCAAGG + Intronic
962623876 3:137205477-137205499 CAGCCTGGGGAGCAGAGGCAAGG - Intergenic
962832715 3:139158503-139158525 GTGCCTGGGGAGGGGTGCCATGG + Intronic
962881264 3:139578946-139578968 CTGCAGGGCCAGCCGGGCCATGG + Exonic
966860857 3:184230287-184230309 TTACCTGGGCAGCCGGGCCGCGG - Intronic
966862554 3:184238697-184238719 CTGCCTGTGGAGCCTGGGCCTGG - Exonic
967918768 3:194599002-194599024 CAGCCTTGGCAGCCAGGCCAGGG + Intronic
968132241 3:196198490-196198512 CGGGCAGGGGAGCCGGACCAGGG - Intronic
968473439 4:792130-792152 CTGCCTGGGGCCCTGGGCCGAGG - Intronic
968523174 4:1043628-1043650 CTGCATGGGGAGCAGGGCGTTGG + Intergenic
968530770 4:1090240-1090262 CTGGCTGGCAAGCAGGGCCAAGG + Intronic
968620600 4:1601910-1601932 GGGCCTGGGGAGGTGGGCCAGGG + Intergenic
968775021 4:2535576-2535598 CTGCCCTGAGACCCGGGCCACGG - Intronic
968984561 4:3868136-3868158 CTGCCTGGGAAGCACGGCCCTGG + Intergenic
969364787 4:6688021-6688043 CTGCCTGGGTAGCCGCTCCATGG + Intergenic
969623849 4:8292603-8292625 CTGTCAGGGGAGCTGGGGCAAGG + Intronic
974968104 4:68789670-68789692 CTGCATGGGGAACAGGGACAGGG - Intergenic
975011516 4:69360368-69360390 CTGCATGGGGAACAGGGACAGGG - Intronic
977569015 4:98610894-98610916 ATACCTGGGGAGCGGGGTCAGGG - Intronic
977962955 4:103106250-103106272 TTGCCTGAGGAGGCGTGCCAAGG + Exonic
986169381 5:5303441-5303463 CTGCATGGAGCGCCGGGCCCTGG + Exonic
986366910 5:7041615-7041637 CTGCATGCTGAGCCGGGCCACGG + Intergenic
987088059 5:14487762-14487784 CGGCCTCGGGGGCCGCGCCAGGG - Exonic
987360955 5:17105940-17105962 CTGTATGTGGAGCCAGGCCATGG + Intronic
992150108 5:73894523-73894545 CTGCCTGGGGAGGCTCGCCTGGG - Exonic
997473649 5:134130445-134130467 GTGCCAGGGGAGCTGGGCCAAGG + Intronic
997595121 5:135102203-135102225 CAGCCTGGGGAGCCTGGGGAAGG - Intronic
998613331 5:143712815-143712837 CTACCTGGGGAACTGGGCCTTGG + Intergenic
999246941 5:150160106-150160128 CTGCCTGGGGAGCCTGGGAGTGG - Intergenic
999368607 5:151039067-151039089 CAGCCAAGGGACCCGGGCCAAGG + Intronic
1001150162 5:169220218-169220240 CTGCCTGAGGATCCCCGCCATGG - Intronic
1002690272 5:181045577-181045599 CAGCCTGGGGAGCCGAGCTCAGG + Exonic
1004324943 6:14666049-14666071 CCGCCTGGGGTGCGGGGTCAGGG - Intergenic
1005288970 6:24359915-24359937 CTGGTTGGGGAGGCGGGCCCAGG + Intergenic
1005786677 6:29251297-29251319 CAGCCTGGGGAGGAGGGGCAAGG + Intergenic
1006167016 6:32071039-32071061 CTGCCTGAGGAGCCATCCCAGGG + Intronic
1006838651 6:37014502-37014524 CTGCCTGTGCAGCCCAGCCATGG - Intronic
1007479864 6:42142672-42142694 CGGCCTGGGGAGCTGGGCGGCGG - Intergenic
1007784093 6:44270536-44270558 CAGGCTGGGGGGCCGGGCCGGGG - Exonic
1007795294 6:44342481-44342503 TTGCCTGTGACGCCGGGCCATGG + Intronic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1010753639 6:79642504-79642526 CTGCCTGGAGAGCCGGGAGAGGG + Intronic
1012818418 6:104054192-104054214 TGGCATGGGGAGCCGGGCCCAGG - Intergenic
1012938161 6:105389755-105389777 CTGCCTCTGGATCCGGGCTAGGG + Intronic
1016759586 6:147722526-147722548 CTGCCTAGGGAGAGGGGCCAGGG - Intronic
1017324512 6:153130737-153130759 CGGCCGGGAGGGCCGGGCCAGGG - Intronic
1017774850 6:157672826-157672848 CTGCCCGGGAAGCCTGGCCTGGG + Exonic
1017882908 6:158573861-158573883 CTGGTTGGGGAGACAGGCCATGG + Intronic
1019038495 6:169083228-169083250 CTTCCTAGGGAGGAGGGCCAGGG - Intergenic
1019279626 7:193276-193298 CAGCCTGGGCAGCAGGTCCAGGG - Exonic
1019433595 7:1010790-1010812 AAGCCGGGGCAGCCGGGCCACGG + Intronic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019700968 7:2474953-2474975 CGGCCACGGGAGCAGGGCCATGG - Intronic
1019733107 7:2638200-2638222 CTGCCTGGGGACCGGGCCCCAGG - Intronic
1020107636 7:5429468-5429490 CTTCCTGGGGCGCCGCGGCAGGG - Intergenic
1020119680 7:5496018-5496040 CTTCCTCAGGAGCAGGGCCATGG - Intronic
1020152481 7:5693801-5693823 ATGCCTGGGCTGCCTGGCCATGG - Intronic
1022469858 7:30675394-30675416 CTGGCTGGGGACCTGGGCCTTGG - Intronic
1022843961 7:34191527-34191549 CAGCCTGAGGGGCCTGGCCAAGG - Intergenic
1023042401 7:36183093-36183115 CTGCCTCAGGAGCCGGGCTTAGG - Intronic
1024565677 7:50678066-50678088 TTGCCTGGGGAGCACAGCCAAGG - Intronic
1026976715 7:74503188-74503210 CTCCCTGGGCAGCGGGGCCCTGG - Intronic
1029448404 7:100627375-100627397 CTGCCCTGCGAGCTGGGCCACGG + Exonic
1029505970 7:100964500-100964522 CTGCCTGGGAAGGCAGGACAAGG - Intronic
1029514544 7:101017379-101017401 CTGCCTGGGGAGCCGCCCGCTGG - Intronic
1029570024 7:101363150-101363172 CTGCCAGGGGAGCCGGCGCCGGG - Exonic
1031729757 7:125284764-125284786 AGGCCTGGGGAGCTGGGTCAGGG + Intergenic
1031996938 7:128239102-128239124 CTGCCTGCGGGGTCGGGCAAAGG + Intergenic
1032125388 7:129189215-129189237 CTGCTGGGGGACCCGGGCCGGGG + Exonic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1035289653 7:157829774-157829796 ATGCCTGAGGAGTCGGGCCAGGG - Intronic
1035327854 7:158076390-158076412 CTCCCTGGGGAGCTGGTGCATGG + Intronic
1035604658 8:921811-921833 CAGCCAAGGGAGCCGGGCCAGGG + Intergenic
1035780607 8:2224446-2224468 CTGCCTGGGCTGCCGTGACACGG - Intergenic
1036217522 8:6892991-6893013 ATGCCTGGGGAACCCTGCCAAGG + Intergenic
1036286461 8:7447821-7447843 ATCCCTGGGGAGCCAGTCCATGG + Intronic
1036294118 8:7521602-7521624 CTGCCTGCGGAGGCGGGGCTGGG + Intergenic
1036328444 8:7799389-7799411 CTGCCTGCGGAGGCGGGGCTGGG - Intergenic
1036335015 8:7863707-7863729 ATCCCTGGGGAGCCAGTCCACGG - Exonic
1036654831 8:10671401-10671423 CTGCCAGAGGAGCCTGGACATGG + Intronic
1037887294 8:22601734-22601756 CTGCCCGGGGAGGCAGGCCCAGG - Exonic
1037946478 8:22992841-22992863 CTTCCTGGGAGGCAGGGCCAGGG + Intronic
1038229757 8:25689078-25689100 CACCCTGGGGATCCCGGCCAGGG + Intergenic
1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG + Intergenic
1039377140 8:37045735-37045757 CTGCCTAGGAAGCAGGGCCCAGG + Intergenic
1039981957 8:42415523-42415545 CTGCCTGCTGGGCCGGGCCGGGG + Intergenic
1044489338 8:92793573-92793595 CTACCTGGGGAGCCAGACTAGGG + Intergenic
1044821899 8:96160773-96160795 CCGCCCGAGGAGCCGGGCCCCGG - Exonic
1047351743 8:124080683-124080705 CAGCTTGGGGAGATGGGCCAGGG + Intronic
1047480010 8:125272925-125272947 CTGACTTGGGAGCTAGGCCAGGG + Intronic
1048976318 8:139674871-139674893 GTCCCTGGGGTGCCAGGCCAGGG - Intronic
1049235500 8:141510417-141510439 CAGCTTGGGGACCCGGGCCTGGG - Intergenic
1049277635 8:141727879-141727901 CAGCCTGGGAAGCCGGGGAATGG + Intergenic
1049431376 8:142566859-142566881 CTGCCCTGGCAGCCTGGCCAAGG + Intergenic
1049592515 8:143469021-143469043 GGCCCTGGGGAGCCTGGCCAGGG - Intronic
1049601661 8:143510587-143510609 CACCCTGGGGAACAGGGCCAGGG - Intronic
1049777194 8:144412227-144412249 CTGCCTGAGGAGTGGGGTCAGGG - Intronic
1049789492 8:144466288-144466310 CAGCCGTGGGAGCCGGGCCGTGG + Exonic
1049799800 8:144512505-144512527 CTGCCTGAGGACCCAGGGCAAGG - Exonic
1052994805 9:34546285-34546307 CTGCCAGAGGGGCCGGTCCAAGG - Intergenic
1053466036 9:38309311-38309333 CCCCCTGGGGAGCCTGGCAAGGG + Intergenic
1055785056 9:79863160-79863182 CTGCCTGGAGAGGAGGGCCTAGG - Intergenic
1055866579 9:80821402-80821424 TTCCCTGGGGAGCAGGTCCATGG - Intergenic
1056235877 9:84593749-84593771 CTGCCTAGAGAGCTGGGCCTTGG - Intergenic
1056814313 9:89790465-89790487 CTCCCTGGGGAGTCGGGGCAGGG + Intergenic
1057019053 9:91681618-91681640 GTGCCTGGAGAGCCGGGCGCCGG - Intronic
1057186677 9:93061082-93061104 CTGACCTGGGAGCAGGGCCAGGG - Intronic
1057314798 9:93961282-93961304 CAGCCTGGGGAGCTAGGCCTGGG + Intergenic
1057783817 9:98072022-98072044 CTGCCTGGGGAGCAGAGGGAAGG - Intronic
1057846604 9:98530953-98530975 CTGCCCTGGGAGCCTGGCCCGGG + Intronic
1059167424 9:112091972-112091994 GAGCCTGGGGAGCTGAGCCAAGG - Intronic
1060115556 9:120937366-120937388 CTTTCTGGGCAGCCAGGCCAAGG - Intergenic
1060397505 9:123326506-123326528 CTGCCAGGAGGGCAGGGCCACGG + Intergenic
1060399369 9:123339286-123339308 CCGCCTGAGGAGCGGGGGCATGG - Intergenic
1060995579 9:127873510-127873532 CTGCCGGGGGAGGCGGGTGATGG - Intronic
1061260088 9:129475426-129475448 CTGCCCTGGGAGCCGGTCCAGGG - Intergenic
1061312607 9:129773933-129773955 CTGCCTGAGGCCCAGGGCCAGGG + Intergenic
1061486785 9:130924250-130924272 CTGCCCGGGGAACCCGGCCCCGG - Exonic
1061864284 9:133484626-133484648 CTGCCTGGGGCGGGAGGCCACGG - Intergenic
1061864961 9:133487439-133487461 CTCCCTGGGGACCCCGGCCCTGG - Intergenic
1061911311 9:133726629-133726651 CTGCCTGGAGAGAAAGGCCAGGG - Intronic
1062120043 9:134829477-134829499 CTGCGTGAGGAGCCCGGCCTGGG - Intronic
1062130162 9:134888293-134888315 CTGGCTGGGGACCGGGGACAGGG - Intergenic
1062145127 9:134984847-134984869 CTTCCTGGGGAGCCATTCCATGG - Intergenic
1062250568 9:135591800-135591822 CTGCCTGGGGAGGGAGGGCAGGG - Intergenic
1062277369 9:135737225-135737247 CTGCCTGGGGAGCCCTGCTGTGG + Intronic
1062372967 9:136249531-136249553 CTGCCTGGGGAGCTGGGAAAAGG + Intergenic
1062450494 9:136613876-136613898 CTGGGTGGGGAGCAGGGCCCAGG - Intergenic
1062510405 9:136902270-136902292 CTCCCTGGGGAGGTGGCCCAGGG + Intronic
1185508180 X:644176-644198 CATCCGCGGGAGCCGGGCCAGGG - Intronic
1190220425 X:48509146-48509168 CCGCCTGGGGAGGCCGGCCCAGG - Intronic
1190827361 X:54029709-54029731 CTGCCTGGGGCACTGGGCCCAGG - Intronic
1197774652 X:130111093-130111115 CGGCATGGGGAGCCGTGCCAGGG + Intergenic
1199856350 X:151762045-151762067 CTGCCTGAGGAGCGGGAACATGG + Intergenic
1200175994 X:154116718-154116740 CTGCCTGGAGGGCCGGGACCTGG + Intergenic
1201858112 Y:18567749-18567771 CTGCCTGGGTGGCTGGGCCATGG + Intronic
1201875209 Y:18752632-18752654 CTGCCTGGGTGGCTGGGCCATGG - Intronic