ID: 900309766

View in Genome Browser
Species Human (GRCh38)
Location 1:2028064-2028086
Sequence CGTCCACACAGGAAGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900309766_900309779 13 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309779 1:2028100-2028122 AGGGCTCCCGGGGCAGGGCCGGG 0: 1
1: 1
2: 6
3: 106
4: 771
900309766_900309778 12 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309778 1:2028099-2028121 CAGGGCTCCCGGGGCAGGGCCGG 0: 1
1: 0
2: 10
3: 106
4: 855
900309766_900309770 -6 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309770 1:2028081-2028103 TGGACGGAGCGCTCCTGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 94
900309766_900309772 2 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309772 1:2028089-2028111 GCGCTCCTGCCAGGGCTCCCGGG 0: 1
1: 0
2: 2
3: 35
4: 323
900309766_900309776 8 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309776 1:2028095-2028117 CTGCCAGGGCTCCCGGGGCAGGG 0: 1
1: 1
2: 3
3: 38
4: 415
900309766_900309769 -7 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309769 1:2028080-2028102 GTGGACGGAGCGCTCCTGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 131
900309766_900309775 7 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309775 1:2028094-2028116 CCTGCCAGGGCTCCCGGGGCAGG 0: 1
1: 1
2: 8
3: 69
4: 454
900309766_900309773 3 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309773 1:2028090-2028112 CGCTCCTGCCAGGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 245
900309766_900309771 1 Left 900309766 1:2028064-2028086 CCTGCAGGCTTCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 178
Right 900309771 1:2028088-2028110 AGCGCTCCTGCCAGGGCTCCCGG 0: 1
1: 0
2: 0
3: 29
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900309766 Original CRISPR CGTCCACACAGGAAGCCTGC AGG (reversed) Intronic
900309766 1:2028064-2028086 CGTCCACACAGGAAGCCTGCAGG - Intronic
900819190 1:4873230-4873252 CGTCAACCCAGGGAGCCTGAAGG - Intergenic
900964666 1:5949660-5949682 CGTCCAGACCTGAAGCCTGAGGG + Intronic
902850497 1:19152087-19152109 CCTCTACACAGTAATCCTGCTGG + Intronic
903450904 1:23453017-23453039 CTTTCACACAGGAAGCCTGGCGG - Intronic
903826301 1:26147906-26147928 CGTGGCCACGGGAAGCCTGCAGG + Intergenic
907305683 1:53511808-53511830 CCACCACACAGCAGGCCTGCAGG - Intronic
907337907 1:53712495-53712517 TGTACACACAGGAGACCTGCAGG - Intronic
907476668 1:54710440-54710462 GGGCCACACAGTAAGTCTGCTGG + Intronic
912856477 1:113172935-113172957 CGTCCACACTGGAAGGGTGTGGG + Intergenic
915323643 1:155069742-155069764 CCTCAGCACAGGAAGCCGGCTGG - Intergenic
918380978 1:183954984-183955006 TAGCCACACAGGAACCCTGCTGG + Intronic
920445103 1:206010405-206010427 CCACCACACAGGCAGCCTCCAGG - Intronic
920648602 1:207820937-207820959 TGTCCCCACAGGGAGGCTGCTGG + Intergenic
1065252268 10:23827752-23827774 CGTGCACACAGGAATCATACCGG - Intronic
1069535960 10:69253340-69253362 TGCCCACACAGAAAGCCTCCGGG + Intronic
1069757622 10:70782779-70782801 AGTCCCCACTGGAGGCCTGCTGG + Intronic
1071493828 10:86154295-86154317 CCTCCTCACAGCAAGCCTACGGG + Intronic
1072669548 10:97419376-97419398 TGTCCTCACAGGAATCCTGTGGG + Intronic
1074825913 10:117215901-117215923 TGTCCCCACAGGGAGGCTGCAGG - Intergenic
1075655745 10:124160015-124160037 CCTGCACCCAAGAAGCCTGCTGG + Intergenic
1075787233 10:125058325-125058347 CGTCCTCACAAGATGCCTCCTGG + Intronic
1076567212 10:131406992-131407014 TGTCCACACATGTAACCTGCAGG - Intergenic
1076662586 10:132065308-132065330 CCTTCACACAGGAATGCTGCTGG + Intergenic
1077154837 11:1086618-1086640 CTCCCACACAGGACACCTGCAGG - Intergenic
1078487814 11:11740226-11740248 CCTCCACACAGCTAGCCTGGAGG - Intergenic
1081487473 11:43542938-43542960 GGTGCACAGAGGAAGCCTGAAGG + Intergenic
1081609597 11:44552760-44552782 AGCCCAGTCAGGAAGCCTGCAGG - Intergenic
1081879149 11:46433300-46433322 CTTCCACAAATGAAGCCTGCTGG + Intronic
1084005341 11:66319734-66319756 CGCCCACACTGGAAGGCTGTGGG + Intergenic
1084106659 11:66985018-66985040 TGCCCTCACAGGAAGCTTGCAGG - Intergenic
1084556829 11:69880539-69880561 CGGCCAGACAGGCAGCCTGGAGG - Intergenic
1085272947 11:75281127-75281149 AGTCCACACCGCAAGCCTGTGGG + Exonic
1089617025 11:119700545-119700567 CTTCCACACCGGCAGCCTGTTGG - Intronic
1092066038 12:5590340-5590362 CGTCGACACAGCAAGCCTACTGG + Intronic
1092541313 12:9421135-9421157 CGTCCTCAGAGGATGCCTGGAGG + Intergenic
1092900027 12:13050020-13050042 CATCCACACAGGAAGAGTGCTGG - Intronic
1094511735 12:31101360-31101382 CGTCCTCAGAGGATGCCTGGAGG - Intronic
1096182011 12:49556270-49556292 CGTCCACACACACAGGCTGCAGG - Intronic
1098143200 12:67471830-67471852 CATGCACACTGGCAGCCTGCAGG + Intergenic
1099600518 12:84730745-84730767 CATCCACACGCTAAGCCTGCTGG + Intergenic
1102870375 12:116409434-116409456 TGTACACACAGAAAGCCTCCTGG - Intergenic
1104663363 12:130628422-130628444 CCGCCACACCTGAAGCCTGCAGG - Intronic
1104719919 12:131039564-131039586 AGTCCACACAGCCAGCCTCCAGG - Intronic
1104745311 12:131206890-131206912 CGTGGACACGGGAAGCCTGAGGG - Intergenic
1104789028 12:131470216-131470238 CGTGGACACGGGAAGCCTGAGGG + Intergenic
1106234589 13:27851250-27851272 ACTCCAGACAGGAAGCCTGAAGG - Intergenic
1106602642 13:31200484-31200506 CGCCCCCACAGGAAGCGCGCAGG + Intronic
1106814502 13:33392266-33392288 CATCCACACATCCAGCCTGCTGG - Intergenic
1108459672 13:50652547-50652569 CATCCTCCCTGGAAGCCTGCTGG - Intronic
1113120571 13:106919812-106919834 CGTCCACACAGGCGGGTTGCTGG - Intergenic
1113715295 13:112501420-112501442 TGTCCACACAGGGCACCTGCAGG + Intronic
1113737292 13:112688105-112688127 AGTCCCAACAGGAAGCCTGCTGG - Intergenic
1118328846 14:64800474-64800496 CATCCCCACAGGAACCCTCCAGG - Intronic
1118727237 14:68637833-68637855 TGCACACACAGGCAGCCTGCTGG + Intronic
1119383148 14:74241048-74241070 TGTCTCCCCAGGAAGCCTGCGGG - Intronic
1119419902 14:74502388-74502410 AGTCCCCACAGGAAGCTTGTAGG + Intronic
1120786295 14:88540453-88540475 AGTTCACACAGGTAGTCTGCAGG + Intronic
1122237581 14:100340766-100340788 CTGCCCCACAAGAAGCCTGCAGG + Intronic
1124350846 15:28954595-28954617 ACTCCAGACAGGAAGCCTGTGGG + Intronic
1124812324 15:32953356-32953378 GCTGCACACAGGAAGCCTCCTGG + Intronic
1128459339 15:67854522-67854544 CCTGCAGACAGGAAGCTTGCAGG + Intergenic
1129543061 15:76366980-76367002 GGTCCACAGAGGAACCCTGTAGG + Intronic
1132222407 15:100114770-100114792 CCTCCACCCAGGAAGCCTTGCGG - Intronic
1132753051 16:1467659-1467681 CGTCCAAACAGGCACCCTGTGGG + Intronic
1133046062 16:3089021-3089043 CCTCCACAGCGGAGGCCTGCAGG - Exonic
1133202591 16:4213240-4213262 TGTCCACAGAGAAAGACTGCAGG + Intronic
1134326395 16:13211865-13211887 CATCCACACAGGAAGAATGGGGG + Intronic
1137301494 16:47152574-47152596 CGCCCACACTGGAAGGTTGCGGG + Intergenic
1142002059 16:87669804-87669826 CATCCACACTGGCTGCCTGCAGG - Intronic
1143708878 17:8719528-8719550 TGTGCTCACCGGAAGCCTGCTGG - Intergenic
1144200295 17:12935006-12935028 CTGCCACAGAGGATGCCTGCAGG - Intronic
1144620924 17:16818097-16818119 TGTCCACACAGGGGGCCTCCTGG + Intergenic
1144952538 17:19001971-19001993 AGTCCCCACAGAGAGCCTGCTGG - Intronic
1145033686 17:19525066-19525088 GGTCCACCCAGAAAGCCTGGAGG + Intronic
1145884688 17:28373706-28373728 ACTCCACATAGCAAGCCTGCAGG - Intronic
1146746217 17:35333088-35333110 CGTCCACACAGAAACCCCACTGG - Intergenic
1148114845 17:45169545-45169567 CTTCCACACCGAGAGCCTGCAGG + Exonic
1151271422 17:72999341-72999363 CTTCCACTCTGCAAGCCTGCTGG + Intronic
1152609378 17:81308144-81308166 GGTCCTCACAGGCACCCTGCAGG + Intergenic
1159612132 18:70537762-70537784 TGTACACACAGGAAGCTTTCTGG - Intergenic
1160515700 18:79478192-79478214 CAACCACACAGGAAGCCAACAGG + Intronic
1160716344 19:578440-578462 CGTCCATACTGCAAGCCTGAGGG + Intronic
1162514086 19:11137943-11137965 AGCCCACACAGGAAGCGTCCTGG + Intronic
1166067194 19:40366762-40366784 CCTCCCCACAGAAAGCCCGCTGG + Exonic
1166201010 19:41238122-41238144 CGTCTCCACAGGAAGCCAGTGGG - Exonic
1166695983 19:44851606-44851628 TGCCACCACAGGAAGCCTGCAGG + Intronic
1167763120 19:51461840-51461862 GGGCCCCACAGGAAGCCTGGGGG + Intergenic
926120407 2:10238552-10238574 CGTCCAAACAGCAGGCCTGCTGG - Intergenic
927886377 2:26721198-26721220 TGTCCACAGAGGAGTCCTGCAGG - Intronic
929715553 2:44305858-44305880 TGTCACCACAGGAAGCCTTCTGG + Intronic
930092480 2:47541216-47541238 CGTGTCCACAGGAAGCCTGTTGG + Intronic
931748035 2:65307882-65307904 CGTCCTCACTGGAAGCCCGTTGG - Intergenic
933702637 2:85266620-85266642 AGTCCCCACCGGAAGCATGCTGG - Intronic
934658829 2:96132411-96132433 CTTCCCCACAGGAAGCAGGCAGG + Intronic
936516177 2:113182905-113182927 CGTCCACACAGGTAGTGTTCTGG + Exonic
938755635 2:134376605-134376627 CTTCCAGACAGGAGGCATGCTGG - Intronic
940321724 2:152384574-152384596 CTTTCACTCAGGAAGCCTGAGGG - Intronic
943782239 2:191837344-191837366 GGTGCACTCAGGAAGCCTTCTGG + Intronic
947414509 2:229880015-229880037 CGTTCACAGAGGAACACTGCCGG - Exonic
948194597 2:236085811-236085833 CCTTCACAAAGGAAGCCGGCTGG - Intronic
949064762 2:241983397-241983419 CTGGCACACAGGCAGCCTGCGGG - Intergenic
1168848176 20:959356-959378 GGGTCACACAGGAAGCCTTCAGG - Exonic
1169005601 20:2204700-2204722 GGCGCACACAGCAAGCCTGCCGG + Intergenic
1172778166 20:37420102-37420124 AGGCCACAGAGGAAGCCAGCAGG - Intergenic
1173260130 20:41427035-41427057 GGGCCACACAGAAAGTCTGCAGG - Intronic
1175412951 20:58783521-58783543 TTTCCACACAGGAAGCCGGGGGG + Intergenic
1175658915 20:60795326-60795348 CGTCCTTACAGGAAGCTTCCAGG + Intergenic
1176187993 20:63791985-63792007 CCTCCACACAGAACGCCGGCTGG - Intronic
1178420528 21:32439428-32439450 CGTCCACACGGTAATCATGCTGG - Intronic
1179931618 21:44574556-44574578 CAGGCACACAGCAAGCCTGCTGG - Exonic
1179934186 21:44592010-44592032 CGGGCACACAGCAGGCCTGCTGG + Exonic
1181386504 22:22549766-22549788 AGTCCACATAGAGAGCCTGCAGG + Exonic
1181669908 22:24421194-24421216 GGTCCACGCAGGAAGGTTGCGGG + Intronic
1183063619 22:35349665-35349687 CGTCCTCACAGAGAGCCTCCTGG - Intergenic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
1183748272 22:39704679-39704701 CGGACCCACAGGCAGCCTGCAGG - Intergenic
1184313316 22:43663036-43663058 GCTCCTCACAGGAAGCCTGTAGG - Intronic
1184589771 22:45474294-45474316 CGTGGACAAACGAAGCCTGCTGG + Intergenic
1184596775 22:45518698-45518720 CGTCCGCACAGCAGGCCTCCAGG - Exonic
950073999 3:10174277-10174299 CCTGCACACAGAAAGCCTCCAGG - Intronic
950267755 3:11587832-11587854 CATCCACACAAGAAACCTGGGGG + Intronic
952831379 3:37567987-37568009 CCTCCACACAGAACTCCTGCTGG - Intronic
952964757 3:38614258-38614280 TGTCCACACAGCAAGCTTCCCGG + Intronic
954745510 3:52785387-52785409 CCTCCACACAGGCATCCTGGGGG + Intronic
956184937 3:66553411-66553433 TGTCCTCACAAGAACCCTGCAGG - Intergenic
956879901 3:73499919-73499941 TGGCCACACAGAAAGCCTGGTGG + Intronic
958142178 3:89575393-89575415 CATCCACACAGGCAGAGTGCAGG - Intergenic
961664090 3:128485777-128485799 GGTCCCCCCAGGAAGCCTCCGGG + Exonic
962811117 3:138960411-138960433 CCTCCACCCAGGAACCCGGCCGG - Intergenic
962871122 3:139493957-139493979 CGCCCACATAGGAATCCTTCTGG - Intergenic
966221462 3:177555622-177555644 GGTTCAAACAGCAAGCCTGCTGG - Intergenic
967983135 3:195077518-195077540 CGTCCACCCAGCCAGCCTCCTGG + Intronic
970322490 4:14888546-14888568 AAGCCACACAGCAAGCCTGCAGG + Intergenic
976620393 4:87121098-87121120 CTTCCACAAAGGGAGGCTGCCGG - Intronic
980651581 4:135723760-135723782 CGTGCACACAGGAAACTTGGTGG - Intergenic
984017308 4:174441617-174441639 CCTCCACACAGAATCCCTGCTGG - Intergenic
984920511 4:184760356-184760378 TGTCCACGGAGAAAGCCTGCAGG - Exonic
985158629 4:187020109-187020131 AGCCCAGAGAGGAAGCCTGCTGG + Intergenic
985541557 5:489817-489839 TGTCCAGACGGGAAGGCTGCCGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985779556 5:1863054-1863076 CTTCCCCAAAGGGAGCCTGCAGG - Intergenic
985931217 5:3059170-3059192 AGTACTCACAGGAAGCCCGCGGG - Intergenic
985935198 5:3092281-3092303 CCTCCACACAGCATGTCTGCAGG - Intergenic
986128458 5:4905239-4905261 TGGCCACACAGGAAGCTTCCAGG + Intergenic
986168757 5:5298272-5298294 TGCCCACACACGATGCCTGCTGG - Intronic
986646123 5:9917686-9917708 CGTGCACACACGAGGCGTGCAGG - Intergenic
997262872 5:132477461-132477483 CTTCCCTAAAGGAAGCCTGCAGG + Intergenic
997665953 5:135629615-135629637 CGCCCACAGAGTCAGCCTGCTGG - Intergenic
998819864 5:146048786-146048808 AGTCCACACAGGAATCAGGCAGG - Intronic
999082979 5:148861684-148861706 GTTCCACACAAGAATCCTGCAGG + Intergenic
1002105330 5:176877099-176877121 AGTCCTCACAGGAAGGCTCCTGG + Intronic
1006400210 6:33813279-33813301 CCTCCACACACTAAGCCGGCTGG - Intergenic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1007406348 6:41638259-41638281 AGCCCCCACAGGAAGCCGGCTGG - Intronic
1014211950 6:118717356-118717378 AGTCTACACAGAAAGGCTGCAGG - Intergenic
1017501596 6:155030520-155030542 CGTCCAAACCGCAAGCCTCCTGG + Intronic
1019317958 7:399934-399956 CCTCCACACAGGGGGTCTGCTGG + Intergenic
1019434001 7:1012439-1012461 CGGGCGCTCAGGAAGCCTGCGGG - Intronic
1019576956 7:1742276-1742298 CGGCCGCACAGGAAGCGTGTAGG - Intronic
1022097170 7:27148193-27148215 CCTCCAAACAGGAAACCTGAAGG + Intronic
1029548579 7:101224185-101224207 CGACCAAACAGGAAGGCTTCCGG - Exonic
1029787447 7:102806837-102806859 CCTCCACTCAGGGAGTCTGCTGG - Intronic
1032421131 7:131780689-131780711 TTTCCACAAAAGAAGCCTGCTGG + Intergenic
1034227770 7:149496975-149496997 TGTCCTCACAGCAAGCCTGTGGG - Intronic
1034242942 7:149624015-149624037 TGTCCTCACAGCAAGCCTGTGGG - Intergenic
1035223575 7:157421021-157421043 CGTCCACAGAGGCAGCCTTGGGG - Intergenic
1036418336 8:8571754-8571776 TGTGCACTCAGGCAGCCTGCAGG + Intergenic
1037581161 8:20246792-20246814 TGTCCCCAAAGGACGCCTGCAGG - Exonic
1039105871 8:33988843-33988865 CTTCCACACAGGAATTTTGCAGG + Intergenic
1041545215 8:59034845-59034867 TGTCCACACAGCAACCCTACGGG + Intronic
1047971642 8:130089508-130089530 CGTCCACAGACGAAAGCTGCAGG + Intronic
1048856404 8:138690000-138690022 AATCCACACAGCAACCCTGCTGG - Intronic
1049779960 8:144424396-144424418 CGTTCACCCAGGAGGCCTGCAGG - Intronic
1049804461 8:144532640-144532662 CATCCACCCAGGGAGCCAGCAGG - Intronic
1050553835 9:6771979-6772001 AGTTCACACTGAAAGCCTGCTGG - Intronic
1051368709 9:16339947-16339969 CACCCACCCAGGAAGCCTGGAGG + Intergenic
1060811874 9:126614759-126614781 TGTCCCCTCAGGACGCCTGCCGG - Intronic
1061408479 9:130405539-130405561 CGGCCACCCAGGGAGCCTGGGGG + Intronic
1062630644 9:137461674-137461696 CCTCCCCACAGGAAGCAGGCTGG - Intronic
1203793730 EBV:165072-165094 CGGCCACACAGGAGGCCAACAGG - Intergenic
1189683377 X:43539311-43539333 CTTCCTCCCAGCAAGCCTGCAGG + Intergenic
1189721750 X:43926960-43926982 CGTCCACACAGAAACCCCGAAGG - Intergenic
1193692219 X:84659590-84659612 GGTCCCCACAGGATCCCTGCAGG - Intergenic
1199777772 X:151030607-151030629 TGGCCAGACAGGAAGCCTACAGG - Intergenic
1200230820 X:154443120-154443142 AGGCCACACGGGAAGGCTGCAGG - Exonic