ID: 900310171

View in Genome Browser
Species Human (GRCh38)
Location 1:2029731-2029753
Sequence CGGCCTGGAGACCTTGACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 125}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310171_900310189 27 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310189 1:2029781-2029803 GCCAGGGACAGCACTGCTGGGGG 0: 1
1: 1
2: 4
3: 43
4: 339
900310171_900310180 -1 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310180 1:2029753-2029775 GAGGGCAGAGGTGAGGGCCTGGG 0: 1
1: 0
2: 8
3: 104
4: 871
900310171_900310177 -7 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310177 1:2029747-2029769 CAGGCCGAGGGCAGAGGTGAGGG 0: 1
1: 0
2: 3
3: 57
4: 501
900310171_900310179 -2 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310179 1:2029752-2029774 CGAGGGCAGAGGTGAGGGCCTGG 0: 1
1: 0
2: 6
3: 69
4: 679
900310171_900310188 26 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310188 1:2029780-2029802 AGCCAGGGACAGCACTGCTGGGG 0: 1
1: 0
2: 1
3: 29
4: 345
900310171_900310186 24 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310186 1:2029778-2029800 CGAGCCAGGGACAGCACTGCTGG 0: 1
1: 0
2: 3
3: 17
4: 191
900310171_900310182 10 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310182 1:2029764-2029786 TGAGGGCCTGGGGCCGAGCCAGG 0: 1
1: 0
2: 3
3: 61
4: 551
900310171_900310183 11 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310183 1:2029765-2029787 GAGGGCCTGGGGCCGAGCCAGGG 0: 1
1: 0
2: 1
3: 46
4: 524
900310171_900310176 -8 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310176 1:2029746-2029768 CCAGGCCGAGGGCAGAGGTGAGG 0: 1
1: 0
2: 7
3: 55
4: 585
900310171_900310187 25 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310187 1:2029779-2029801 GAGCCAGGGACAGCACTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 310
900310171_900310181 0 Left 900310171 1:2029731-2029753 CCAAGGTCAAGGTCTCCAGGCCG 0: 1
1: 1
2: 0
3: 8
4: 125
Right 900310181 1:2029754-2029776 AGGGCAGAGGTGAGGGCCTGGGG 0: 1
1: 0
2: 8
3: 116
4: 876

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310171 Original CRISPR CGGCCTGGAGACCTTGACCT TGG (reversed) Exonic
900310171 1:2029731-2029753 CGGCCTGGAGACCTTGACCTTGG - Exonic
900408307 1:2502028-2502050 CGGTCTGGAGAGCTGGCCCTGGG + Intronic
900532018 1:3159127-3159149 CAGCCTTGAGACCTTGGGCTGGG + Intronic
901664122 1:10816892-10816914 CGGCCTAGAGGCCTAGAGCTGGG - Intergenic
902226472 1:14999512-14999534 CGCCATCCAGACCTTGACCTTGG + Intronic
904786166 1:32984672-32984694 AGGCCTGGAGACCTAGATTTTGG + Intergenic
906273735 1:44501014-44501036 CAGCCTGGAGGCCTTGTGCTGGG - Intronic
907950607 1:59179632-59179654 CCCCATGGACACCTTGACCTTGG - Intergenic
909998176 1:82307120-82307142 CTGCCTGGAAAGCTTGCCCTTGG - Intergenic
912810927 1:112793912-112793934 AGGCCTTGAGACCTTGACTGCGG + Intergenic
913174853 1:116263982-116264004 CGGGCTGGAGGCCTCAACCTTGG - Intergenic
913209830 1:116572820-116572842 ATACCTGGAGACCATGACCTGGG - Intergenic
921610347 1:217206328-217206350 TGGCCTGGAGACATTGTCTTGGG - Intergenic
923034872 1:230278843-230278865 CTGCCTGGAGGCCTTGGTCTGGG - Intronic
1063070084 10:2652734-2652756 CAGCCTGAAGACCTTGACCAAGG + Intergenic
1063575826 10:7261149-7261171 CGGGCTGCAGACCTTGTGCTGGG - Intronic
1072268647 10:93754364-93754386 CCACCTGTAGACCTTGTCCTTGG + Intergenic
1072736000 10:97880156-97880178 GGGGCTGGGGACCTTGATCTGGG + Intronic
1072924789 10:99607558-99607580 CGGCCTGGAGACCAGGACGCAGG + Intergenic
1074544439 10:114391708-114391730 GGGCCTTGACACCTTGACCCTGG - Intronic
1075525083 10:123177424-123177446 TGGCCTGAAGACAGTGACCTTGG + Intergenic
1077114389 11:876812-876834 CTGCCTAGAGACCTTGGCCAGGG - Intronic
1077755252 11:5021790-5021812 AGGCCTGCTGACCTTGGCCTTGG - Intergenic
1081582548 11:44362219-44362241 GGACCTGGCGACCTGGACCTGGG + Intergenic
1083616189 11:64027788-64027810 CAGCAAGGAGCCCTTGACCTAGG + Intronic
1084648017 11:70472015-70472037 TGTCCTGGAGACCTGGAGCTTGG + Intronic
1088360338 11:108982768-108982790 CTGGCTAGAGACCTTGACCCTGG + Intergenic
1088549146 11:110992764-110992786 CTGCCTGGAGGCCTTGACAGTGG - Intergenic
1092490183 12:8937919-8937941 GGGCATGGAGAACGTGACCTGGG + Exonic
1093511693 12:19936603-19936625 CTTCCTGGAGACCTTGAGCCAGG + Intergenic
1096759131 12:53825341-53825363 CTGCCTGGAGGCCTCTACCTCGG + Intergenic
1096946172 12:55411996-55412018 GGGCATGGAGAACGTGACCTGGG - Intergenic
1101865609 12:108517547-108517569 CTGCCTGGAGTCCTTTTCCTTGG - Intronic
1112045680 13:95595126-95595148 TGGCCTGGAGCCCTACACCTAGG - Intronic
1115761646 14:36582571-36582593 CACCCTGGAGACCCGGACCTCGG - Exonic
1117503833 14:56380926-56380948 AGCACTGGAGACTTTGACCTTGG - Intergenic
1120853799 14:89195589-89195611 CCTCCTGGAGATCTTGTCCTGGG - Intronic
1120953200 14:90061107-90061129 CGGCCAGGAGACCTTGACCTTGG - Intergenic
1121863083 14:97337660-97337682 CCTCCTTGAGACCATGACCTTGG - Intergenic
1127750484 15:62036011-62036033 CTGCCTGGAGACCTGGAACGAGG - Intronic
1128799666 15:70489555-70489577 GGGCATGGAGGCCTTGAGCTGGG - Intergenic
1130182328 15:81643185-81643207 CTGCCTGCAGACCTTGCACTTGG + Intergenic
1131266531 15:90918704-90918726 CGGCCTGGAGGCCAAGAACTTGG + Exonic
1135173520 16:20208027-20208049 CCACCTGGAGTCCTTGGCCTTGG + Intergenic
1136619153 16:31416502-31416524 CAGCCTGCAGACCCTGACCGTGG + Exonic
1138354565 16:56367052-56367074 CTCCCTGGAGAGCTTGCCCTAGG + Intronic
1139752739 16:69119410-69119432 GGGCCAGGAGCCCTTGACATGGG + Exonic
1140896715 16:79331224-79331246 TGGCCTGGAAAACTAGACCTTGG + Intergenic
1141998094 16:87647791-87647813 TGACCTGGAGACCTCCACCTAGG - Intronic
1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG + Intergenic
1145394982 17:22487656-22487678 CAGCCTGGAGAGCTTGCCCAGGG - Intergenic
1148444182 17:47727670-47727692 GAGCCTGGAGCCCTTGACCTTGG + Intergenic
1149658651 17:58323439-58323461 CTGCCTCCAGCCCTTGACCTAGG + Intronic
1149660408 17:58331697-58331719 TGGACTGGAGACCAAGACCTTGG - Intergenic
1150484236 17:65532925-65532947 CAGCCTGGAGCCCTAAACCTGGG + Intronic
1151945436 17:77317228-77317250 CAGCCTGGTGACCCTGATCTCGG - Intronic
1152611731 17:81318208-81318230 CTGCCCCGGGACCTTGACCTTGG + Intronic
1154002434 18:10493888-10493910 TGGCCTGGAGACCTTGGGCCAGG - Intergenic
1160780129 19:873814-873836 CGGCCTGCAGGCCTTGGCGTGGG + Intronic
1160862879 19:1245113-1245135 AGGCCTGGAGACCAGGAACTCGG - Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161578994 19:5070562-5070584 GGGCCTGGAGACCGTGACGTGGG + Intronic
1161620135 19:5293261-5293283 CGGCCTGGGGAGCTCGGCCTGGG + Intronic
1162523329 19:11194393-11194415 GGGGCTGGGGACCTTGCCCTGGG - Intronic
1164751203 19:30656144-30656166 AGTCCTGGAGACCTTCTCCTTGG + Intronic
1165858613 19:38894912-38894934 CTTCCTGGACACCTTGCCCTAGG + Intronic
1166924726 19:46259571-46259593 CGGGCTGGAGACCCCGCCCTCGG + Intergenic
1168703614 19:58455652-58455674 TGGCCAGGAGCCCTCGACCTGGG + Exonic
1168706122 19:58471200-58471222 TGGCCAGGAGCCCTCGACCTGGG + Exonic
925170850 2:1749530-1749552 AGGCATGGAAACCTTGTCCTGGG - Intergenic
926053434 2:9759228-9759250 CGCCCTGGAGTCCCTGACCCAGG - Intergenic
926063138 2:9816931-9816953 CGGCCTGCAGATCTTGCCCGTGG + Intergenic
926311641 2:11679872-11679894 GGGCCTGGTGGCCTTGGCCTTGG + Intronic
926471877 2:13270730-13270752 CGTCCTCGAGACCTTGGGCTAGG - Intergenic
928312327 2:30221192-30221214 AGGCTTGGAGATCTTGAGCTTGG - Intergenic
937087946 2:119184152-119184174 CGGCTTGTAGACTTTGTCCTTGG + Intergenic
940450407 2:153828567-153828589 CAGCATGGAGACCTTGAACCTGG + Intergenic
941830394 2:169952012-169952034 CTGACTGGACACCTTCACCTGGG - Intronic
942140473 2:172972520-172972542 CTGCATGGTGACCTTCACCTTGG + Intronic
946201320 2:218072489-218072511 GGCCCTGGATACCTTGTCCTGGG - Exonic
949056855 2:241932496-241932518 CTTCCTGGAAACCTTGGCCTGGG + Intergenic
1170533798 20:17320468-17320490 CTGCCTGAGGAACTTGACCTGGG - Intronic
1170852551 20:20017788-20017810 CGGCCTGGAGCCCACGACCTGGG + Intronic
1172196848 20:33097729-33097751 GGGCTGGGAGACCATGACCTCGG - Exonic
1175151049 20:56934698-56934720 CGGCCTGGAGCCTTTGAACAGGG + Intergenic
1176103906 20:63376822-63376844 CAGCCTGTAGACCGTGACCCTGG - Intronic
1180141735 21:45897395-45897417 CGGCCAGGAGACCTAGACCAAGG - Intronic
1180972433 22:19822511-19822533 CTGCCTGCAGACCCTGAGCTGGG + Intronic
1181868710 22:25880691-25880713 CGGCCTGGAGACCTTGTGTAAGG - Intronic
1182031902 22:27165789-27165811 CTGCCTGCAGACCTTGAGCGAGG + Intergenic
1183057621 22:35316628-35316650 CGGCCTGGAAATCTTACCCTAGG + Intronic
952902792 3:38121017-38121039 CGGCCTGGTGACCTGGTCCATGG - Intronic
953237483 3:41119216-41119238 CTGCCTAGGGACTTTGACCTGGG - Intergenic
960967935 3:123118219-123118241 TTGCCTGGAGACATTGGCCTTGG + Intronic
962415458 3:135177765-135177787 TGGCCTGGAGATGCTGACCTGGG + Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
967025198 3:185558610-185558632 CAGCTTGGAGCCCTAGACCTGGG - Intergenic
970608524 4:17704736-17704758 AGGCCTGGAGTCATTGACATGGG - Intronic
972596774 4:40536336-40536358 TGGCTTGGAGACCTTGTTCTTGG + Intronic
973985264 4:56346055-56346077 AGGGCAGGAGTCCTTGACCTTGG + Intronic
981447321 4:144854961-144854983 CGTCCTGTAGACATTGAGCTTGG - Intergenic
985807870 5:2060399-2060421 CGGCGTGGACACCTTGACTGAGG + Intergenic
986282894 5:6337981-6338003 CTCCCTGGAGCCCTTGCCCTGGG + Intergenic
996337937 5:122405154-122405176 AGGCCTGGTGACTCTGACCTTGG - Intronic
997785886 5:136713201-136713223 CCGCCTGAATACCTTGAGCTGGG + Intergenic
1000209755 5:159098289-159098311 TGGCCTGGAGGCATTGCCCTTGG - Intronic
1001244578 5:170096300-170096322 AGGCCTGGAGTCGTGGACCTGGG - Intergenic
1002596042 5:180324015-180324037 GGGCCTGGAGTCCTTGTCCTAGG - Intronic
1002640052 5:180626422-180626444 CGGCCTGGAGACCATCTCCAGGG - Intronic
1002763218 6:217782-217804 CAGCCTGGTGACTTTGACCATGG - Intergenic
1003093387 6:3122859-3122881 CAGCCTGGAGATCGAGACCTTGG + Intronic
1005506986 6:26478007-26478029 AGGCCTGGAAGCCTTCACCTCGG + Intergenic
1018737288 6:166696791-166696813 CCGCCTGGCCACCTTGAGCTGGG + Intronic
1019618830 7:1979627-1979649 CGGCCTGCAGACCCTGCTCTAGG + Intronic
1019733209 7:2638554-2638576 CAGCCTGGCGACCTGGACCTCGG + Intronic
1023018332 7:35987346-35987368 TGGCCTGGAGCCCTTCTCCTTGG + Intergenic
1025246519 7:57321657-57321679 AGGCATGGAGACAGTGACCTGGG + Intergenic
1034258295 7:149736537-149736559 GGTCCTGGAGACCTAGACCTAGG - Intergenic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1034985887 7:155515272-155515294 CGGCCTTGAGACCAGGACCAGGG - Intronic
1038133863 8:24765070-24765092 CTGCCTGGAGACCTGGACTAGGG - Intergenic
1043428427 8:80171433-80171455 CGGGCTGGAGACATGGACCGCGG - Intronic
1044046087 8:87434298-87434320 CGGCCTGGAGACTGTGCTCTTGG + Intronic
1045650926 8:104341087-104341109 AGGCCAGGAGACAATGACCTTGG - Intronic
1045691190 8:104761742-104761764 CAGGCTGCAGCCCTTGACCTTGG - Intronic
1048200917 8:132373241-132373263 AGCCCTGGAGACCTACACCTGGG + Intronic
1049679405 8:143910980-143911002 CGGCCAGAAGACCCTGACCATGG + Intergenic
1051665529 9:19464430-19464452 CAGCCTGGAGACCTTTCCCCTGG - Intergenic
1052861867 9:33442425-33442447 AGGCCTGGAGGCCTTCACCGTGG - Exonic
1056543707 9:87595675-87595697 CTTCCAGGAGACCTTGTCCTTGG + Intronic
1062577145 9:137214114-137214136 TGGCCTGGGGACCTCGCCCTGGG + Intronic
1189794630 X:44634654-44634676 GGGCCAGGAGCCCTTGACATGGG - Intergenic
1192264802 X:69530905-69530927 TGCCCTGGAGATCTTGGCCTTGG + Exonic
1201607700 Y:15805337-15805359 TGTCTTGGAGTCCTTGACCTAGG + Intergenic
1202047273 Y:20747677-20747699 GGGCCTGAACACCCTGACCTAGG - Intergenic