ID: 900310257

View in Genome Browser
Species Human (GRCh38)
Location 1:2030026-2030048
Sequence GGCCAGCTCCTGCGTGACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310257_900310267 17 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310257_900310262 5 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310262 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 30
4: 256
900310257_900310268 18 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310257_900310263 6 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310263 1:2030055-2030077 CGCCGGCAGCGCCGCGTCCCGGG 0: 1
1: 0
2: 2
3: 31
4: 257
900310257_900310271 28 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310257_900310264 7 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310264 1:2030056-2030078 GCCGGCAGCGCCGCGTCCCGGGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310257 Original CRISPR GGCCAGCTCCTGCGTGACGC CGG (reversed) Exonic