ID: 900310259

View in Genome Browser
Species Human (GRCh38)
Location 1:2030047-2030069
Sequence GCGGCGCTGCCGGCGGGAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 261}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310259_900310277 17 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310277 1:2030087-2030109 GGGCTCCTACAGGTCGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 487
900310259_900310280 27 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453
900310259_900310271 7 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310259_900310282 29 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310259_900310274 14 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310259_900310281 28 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310259_900310267 -4 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310259_900310278 20 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310259_900310276 16 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310276 1:2030086-2030108 TGGGCTCCTACAGGTCGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 95
900310259_900310268 -3 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310259_900310273 11 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310273 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 96
900310259_900310275 15 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310259 Original CRISPR GCGGCGCTGCCGGCGGGAGA TGG (reversed) Exonic