ID: 900310261

View in Genome Browser
Species Human (GRCh38)
Location 1:2030054-2030076
Sequence CCGGGACGCGGCGCTGCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 247}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310261_900310276 9 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310276 1:2030086-2030108 TGGGCTCCTACAGGTCGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 95
900310261_900310273 4 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310273 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 96
900310261_900310271 0 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310261_900310280 20 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453
900310261_900310274 7 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310261_900310268 -10 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310261_900310277 10 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310277 1:2030087-2030109 GGGCTCCTACAGGTCGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 487
900310261_900310278 13 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310261_900310282 22 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310261_900310281 21 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310261_900310275 8 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310261 Original CRISPR CCGGGACGCGGCGCTGCCGG CGG (reversed) Exonic