ID: 900310265

View in Genome Browser
Species Human (GRCh38)
Location 1:2030057-2030079
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310265_900310278 10 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310265_900310277 7 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310277 1:2030087-2030109 GGGCTCCTACAGGTCGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 487
900310265_900310271 -3 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310265_900310275 5 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310265_900310281 18 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310265_900310273 1 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310273 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 96
900310265_900310274 4 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310265_900310282 19 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310265_900310280 17 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453
900310265_900310276 6 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310276 1:2030086-2030108 TGGGCTCCTACAGGTCGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310265 Original CRISPR TCCCCGGGACGCGGCGCTGC CGG (reversed) Exonic