ID: 900310266

View in Genome Browser
Species Human (GRCh38)
Location 1:2030066-2030088
Sequence CCATCAGGTTCCCCGGGACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310266_900310286 27 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310286 1:2030116-2030138 CAGGGGAGACGAAGAAGGAGGGG 0: 1
1: 0
2: 4
3: 60
4: 850
900310266_900310276 -3 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310276 1:2030086-2030108 TGGGCTCCTACAGGTCGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 95
900310266_900310280 8 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453
900310266_900310283 22 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310283 1:2030111-2030133 GGAGACAGGGGAGACGAAGAAGG 0: 1
1: 0
2: 8
3: 89
4: 922
900310266_900310281 9 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310266_900310278 1 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310266_900310285 26 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310266_900310282 10 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310266_900310277 -2 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310277 1:2030087-2030109 GGGCTCCTACAGGTCGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 487
900310266_900310284 25 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310284 1:2030114-2030136 GACAGGGGAGACGAAGAAGGAGG 0: 1
1: 0
2: 4
3: 44
4: 661
900310266_900310275 -4 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310266_900310273 -8 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310273 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 96
900310266_900310287 28 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310266_900310274 -5 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310266 Original CRISPR CCATCAGGTTCCCCGGGACG CGG (reversed) Exonic