ID: 900310267

View in Genome Browser
Species Human (GRCh38)
Location 1:2030066-2030088
Sequence CCGCGTCCCGGGGAACCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310253_900310267 29 Left 900310253 1:2030014-2030036 CCCTCTCTGCTGCCGGCGTCACG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310257_900310267 17 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310260_900310267 -10 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310259_900310267 -4 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54
900310254_900310267 28 Left 900310254 1:2030015-2030037 CCTCTCTGCTGCCGGCGTCACGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 900310267 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310267 Original CRISPR CCGCGTCCCGGGGAACCTGA TGG Exonic