ID: 900310268

View in Genome Browser
Species Human (GRCh38)
Location 1:2030067-2030089
Sequence CGCGTCCCGGGGAACCTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310259_900310268 -3 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310254_900310268 29 Left 900310254 1:2030015-2030037 CCTCTCTGCTGCCGGCGTCACGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310260_900310268 -9 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310253_900310268 30 Left 900310253 1:2030014-2030036 CCCTCTCTGCTGCCGGCGTCACG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310257_900310268 18 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30
900310261_900310268 -10 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310268 1:2030067-2030089 CGCGTCCCGGGGAACCTGATGGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310268 Original CRISPR CGCGTCCCGGGGAACCTGAT GGG Exonic