ID: 900310270

View in Genome Browser
Species Human (GRCh38)
Location 1:2030073-2030095
Sequence TAGGAGCCCATCAGGTTCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310270_900310281 2 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310270_900310282 3 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310270_900310283 15 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310283 1:2030111-2030133 GGAGACAGGGGAGACGAAGAAGG 0: 1
1: 0
2: 8
3: 89
4: 922
900310270_900310286 20 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310286 1:2030116-2030138 CAGGGGAGACGAAGAAGGAGGGG 0: 1
1: 0
2: 4
3: 60
4: 850
900310270_900310277 -9 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310277 1:2030087-2030109 GGGCTCCTACAGGTCGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 487
900310270_900310278 -6 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310270_900310276 -10 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310276 1:2030086-2030108 TGGGCTCCTACAGGTCGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 95
900310270_900310284 18 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310284 1:2030114-2030136 GACAGGGGAGACGAAGAAGGAGG 0: 1
1: 0
2: 4
3: 44
4: 661
900310270_900310285 19 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310270_900310287 21 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310270_900310280 1 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310270 Original CRISPR TAGGAGCCCATCAGGTTCCC CGG (reversed) Exonic