ID: 900310271

View in Genome Browser
Species Human (GRCh38)
Location 1:2030077-2030099
Sequence GGAACCTGATGGGCTCCTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310259_900310271 7 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310261_900310271 0 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310257_900310271 28 Left 900310257 1:2030026-2030048 CCGGCGTCACGCAGGAGCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310265_900310271 -3 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86
900310260_900310271 1 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310271 Original CRISPR GGAACCTGATGGGCTCCTAC AGG Exonic