ID: 900310272

View in Genome Browser
Species Human (GRCh38)
Location 1:2030081-2030103
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310272_900310281 -6 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310281 1:2030098-2030120 GGTCGGTGGGGGTGGAGACAGGG 0: 1
1: 0
2: 4
3: 48
4: 503
900310272_900310284 10 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310284 1:2030114-2030136 GACAGGGGAGACGAAGAAGGAGG 0: 1
1: 0
2: 4
3: 44
4: 661
900310272_900310282 -5 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310282 1:2030099-2030121 GTCGGTGGGGGTGGAGACAGGGG 0: 1
1: 0
2: 4
3: 52
4: 645
900310272_900310283 7 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310283 1:2030111-2030133 GGAGACAGGGGAGACGAAGAAGG 0: 1
1: 0
2: 8
3: 89
4: 922
900310272_900310280 -7 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310280 1:2030097-2030119 AGGTCGGTGGGGGTGGAGACAGG 0: 1
1: 0
2: 4
3: 40
4: 453
900310272_900310288 26 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310288 1:2030130-2030152 AAGGAGGGGGCAGCCCGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
900310272_900310286 12 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310286 1:2030116-2030138 CAGGGGAGACGAAGAAGGAGGGG 0: 1
1: 0
2: 4
3: 60
4: 850
900310272_900310287 13 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310272_900310289 29 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310289 1:2030133-2030155 GAGGGGGCAGCCCGCTCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 227
900310272_900310285 11 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310272 Original CRISPR CCGACCTGTAGGAGCCCATC AGG (reversed) Exonic