ID: 900310274

View in Genome Browser
Species Human (GRCh38)
Location 1:2030084-2030106
Sequence GATGGGCTCCTACAGGTCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310259_900310274 14 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310265_900310274 4 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310261_900310274 7 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310260_900310274 8 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
900310266_900310274 -5 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310274 1:2030084-2030106 GATGGGCTCCTACAGGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310274 Original CRISPR GATGGGCTCCTACAGGTCGG TGG Exonic