ID: 900310275

View in Genome Browser
Species Human (GRCh38)
Location 1:2030085-2030107
Sequence ATGGGCTCCTACAGGTCGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310261_900310275 8 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310260_900310275 9 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310259_900310275 15 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310266_900310275 -4 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310269_900310275 -10 Left 900310269 1:2030072-2030094 CCCGGGGAACCTGATGGGCTCCT 0: 1
1: 0
2: 2
3: 12
4: 207
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63
900310265_900310275 5 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310275 1:2030085-2030107 ATGGGCTCCTACAGGTCGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310275 Original CRISPR ATGGGCTCCTACAGGTCGGT GGG Exonic