ID: 900310278

View in Genome Browser
Species Human (GRCh38)
Location 1:2030090-2030112
Sequence CTCCTACAGGTCGGTGGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310265_900310278 10 Left 900310265 1:2030057-2030079 CCGGCAGCGCCGCGTCCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310261_900310278 13 Left 900310261 1:2030054-2030076 CCGCCGGCAGCGCCGCGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 247
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310259_900310278 20 Left 900310259 1:2030047-2030069 CCATCTCCCGCCGGCAGCGCCGC 0: 1
1: 0
2: 0
3: 22
4: 261
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310266_900310278 1 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310260_900310278 14 Left 900310260 1:2030053-2030075 CCCGCCGGCAGCGCCGCGTCCCG 0: 1
1: 0
2: 2
3: 31
4: 236
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310270_900310278 -6 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
900310269_900310278 -5 Left 900310269 1:2030072-2030094 CCCGGGGAACCTGATGGGCTCCT 0: 1
1: 0
2: 2
3: 12
4: 207
Right 900310278 1:2030090-2030112 CTCCTACAGGTCGGTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310278 Original CRISPR CTCCTACAGGTCGGTGGGGG TGG Exonic