ID: 900310279

View in Genome Browser
Species Human (GRCh38)
Location 1:2030092-2030114
Sequence CTCCACCCCCACCGACCTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 177}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310279_900310284 -1 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310284 1:2030114-2030136 GACAGGGGAGACGAAGAAGGAGG 0: 1
1: 0
2: 4
3: 44
4: 661
900310279_900310286 1 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310286 1:2030116-2030138 CAGGGGAGACGAAGAAGGAGGGG 0: 1
1: 0
2: 4
3: 60
4: 850
900310279_900310285 0 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310279_900310293 26 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310293 1:2030141-2030163 AGCCCGCTCAGGAGGCCAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 220
900310279_900310289 18 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310289 1:2030133-2030155 GAGGGGGCAGCCCGCTCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 227
900310279_900310290 23 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310290 1:2030138-2030160 GGCAGCCCGCTCAGGAGGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 821
900310279_900310292 25 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310292 1:2030140-2030162 CAGCCCGCTCAGGAGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 228
900310279_900310287 2 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310279_900310283 -4 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310283 1:2030111-2030133 GGAGACAGGGGAGACGAAGAAGG 0: 1
1: 0
2: 8
3: 89
4: 922
900310279_900310291 24 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310291 1:2030139-2030161 GCAGCCCGCTCAGGAGGCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 324
900310279_900310288 15 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310288 1:2030130-2030152 AAGGAGGGGGCAGCCCGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
900310279_900310294 27 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310294 1:2030142-2030164 GCCCGCTCAGGAGGCCAGGGGGG 0: 1
1: 0
2: 0
3: 45
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310279 Original CRISPR CTCCACCCCCACCGACCTGT AGG (reversed) Exonic