ID: 900310285

View in Genome Browser
Species Human (GRCh38)
Location 1:2030115-2030137
Sequence ACAGGGGAGACGAAGAAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 652}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310269_900310285 20 Left 900310269 1:2030072-2030094 CCCGGGGAACCTGATGGGCTCCT 0: 1
1: 0
2: 2
3: 12
4: 207
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310279_900310285 0 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310272_900310285 11 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310270_900310285 19 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652
900310266_900310285 26 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310285 1:2030115-2030137 ACAGGGGAGACGAAGAAGGAGGG 0: 1
1: 0
2: 3
3: 40
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310285 Original CRISPR ACAGGGGAGACGAAGAAGGA GGG Exonic