ID: 900310287

View in Genome Browser
Species Human (GRCh38)
Location 1:2030117-2030139
Sequence AGGGGAGACGAAGAAGGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2762
Summary {0: 1, 1: 2, 2: 24, 3: 271, 4: 2464}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310266_900310287 28 Left 900310266 1:2030066-2030088 CCGCGTCCCGGGGAACCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310269_900310287 22 Left 900310269 1:2030072-2030094 CCCGGGGAACCTGATGGGCTCCT 0: 1
1: 0
2: 2
3: 12
4: 207
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310279_900310287 2 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310270_900310287 21 Left 900310270 1:2030073-2030095 CCGGGGAACCTGATGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464
900310272_900310287 13 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310287 1:2030117-2030139 AGGGGAGACGAAGAAGGAGGGGG 0: 1
1: 2
2: 24
3: 271
4: 2464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310287 Original CRISPR AGGGGAGACGAAGAAGGAGG GGG Exonic