ID: 900310288

View in Genome Browser
Species Human (GRCh38)
Location 1:2030130-2030152
Sequence AAGGAGGGGGCAGCCCGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310272_900310288 26 Left 900310272 1:2030081-2030103 CCTGATGGGCTCCTACAGGTCGG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 900310288 1:2030130-2030152 AAGGAGGGGGCAGCCCGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
900310279_900310288 15 Left 900310279 1:2030092-2030114 CCTACAGGTCGGTGGGGGTGGAG 0: 1
1: 0
2: 2
3: 28
4: 177
Right 900310288 1:2030130-2030152 AAGGAGGGGGCAGCCCGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310288 Original CRISPR AAGGAGGGGGCAGCCCGCTC AGG Exonic