ID: 900310289 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:2030133-2030155 |
Sequence | GAGGGGGCAGCCCGCTCAGG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 244 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 227} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900310272_900310289 | 29 | Left | 900310272 | 1:2030081-2030103 | CCTGATGGGCTCCTACAGGTCGG | 0: 1 1: 0 2: 0 3: 7 4: 51 |
||
Right | 900310289 | 1:2030133-2030155 | GAGGGGGCAGCCCGCTCAGGAGG | 0: 1 1: 0 2: 0 3: 16 4: 227 |
||||
900310279_900310289 | 18 | Left | 900310279 | 1:2030092-2030114 | CCTACAGGTCGGTGGGGGTGGAG | 0: 1 1: 0 2: 2 3: 28 4: 177 |
||
Right | 900310289 | 1:2030133-2030155 | GAGGGGGCAGCCCGCTCAGGAGG | 0: 1 1: 0 2: 0 3: 16 4: 227 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900310289 | Original CRISPR | GAGGGGGCAGCCCGCTCAGG AGG | Exonic | ||