ID: 900310290 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:2030138-2030160 |
| Sequence | GGCAGCCCGCTCAGGAGGCC AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 856 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 34, 4: 821} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900310279_900310290 | 23 | Left | 900310279 | 1:2030092-2030114 | CCTACAGGTCGGTGGGGGTGGAG | 0: 1 1: 0 2: 2 3: 28 4: 177 |
||
| Right | 900310290 | 1:2030138-2030160 | GGCAGCCCGCTCAGGAGGCCAGG | 0: 1 1: 0 2: 0 3: 34 4: 821 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900310290 | Original CRISPR | GGCAGCCCGCTCAGGAGGCC AGG | Exonic | ||