ID: 900310874

View in Genome Browser
Species Human (GRCh38)
Location 1:2032596-2032618
Sequence TGGGTGGAAGGCCCGCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 121}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900310874_900310883 -7 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310883 1:2032612-2032634 CCACCCAGGGCAGCCAGGGAGGG 0: 1
1: 1
2: 8
3: 82
4: 606
900310874_900310897 27 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310897 1:2032646-2032668 TCCTGGGCCTTTGGGGGAAGGGG 0: 1
1: 1
2: 8
3: 51
4: 434
900310874_900310892 20 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310892 1:2032639-2032661 CTCCAACTCCTGGGCCTTTGGGG 0: 1
1: 0
2: 4
3: 51
4: 398
900310874_900310889 11 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310889 1:2032630-2032652 GAGGGTTGGCTCCAACTCCTGGG 0: 1
1: 0
2: 2
3: 114
4: 2976
900310874_900310890 18 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310890 1:2032637-2032659 GGCTCCAACTCCTGGGCCTTTGG 0: 1
1: 0
2: 2
3: 50
4: 723
900310874_900310895 25 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310895 1:2032644-2032666 ACTCCTGGGCCTTTGGGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 437
900310874_900310891 19 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310891 1:2032638-2032660 GCTCCAACTCCTGGGCCTTTGGG 0: 1
1: 1
2: 1
3: 20
4: 271
900310874_900310896 26 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310896 1:2032645-2032667 CTCCTGGGCCTTTGGGGGAAGGG 0: 1
1: 1
2: 2
3: 35
4: 424
900310874_900310886 -3 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310886 1:2032616-2032638 CCAGGGCAGCCAGGGAGGGTTGG 0: 1
1: 1
2: 8
3: 110
4: 773
900310874_900310893 21 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310893 1:2032640-2032662 TCCAACTCCTGGGCCTTTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 238
900310874_900310888 10 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310888 1:2032629-2032651 GGAGGGTTGGCTCCAACTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 460
900310874_900310899 28 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310899 1:2032647-2032669 CCTGGGCCTTTGGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 58
4: 624
900310874_900310881 -8 Left 900310874 1:2032596-2032618 CCCAAGGGCGGGCCTTCCACCCA 0: 1
1: 0
2: 1
3: 12
4: 121
Right 900310881 1:2032611-2032633 TCCACCCAGGGCAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 60
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900310874 Original CRISPR TGGGTGGAAGGCCCGCCCTT GGG (reversed) Intergenic
900181594 1:1313446-1313468 TGGGTGGAAGGACAACCCGTCGG + Intronic
900310874 1:2032596-2032618 TGGGTGGAAGGCCCGCCCTTGGG - Intergenic
900618909 1:3578056-3578078 TGGGCAGAAGGCCAGCCCTGAGG + Intronic
903700000 1:25239941-25239963 TGGGTGGCAGGCCCTTCCCTGGG + Intergenic
906520224 1:46462365-46462387 TGGGTGGTACTCCTGCCCTTTGG + Intergenic
914346038 1:146799301-146799323 TGGGAGTAAGACCAGCCCTTTGG + Intergenic
915593283 1:156882588-156882610 TGGGTGGAATGCAAGCCTTTGGG - Intergenic
917977534 1:180250061-180250083 TGGGTGGAAGGACAGACCTCTGG + Intronic
920146862 1:203868894-203868916 TGGGTGGAATGCCTGAGCTTAGG - Intronic
922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG + Intergenic
923550793 1:234961199-234961221 AGGTGGGAAGGGCCGCCCTTTGG + Intergenic
924847771 1:247790148-247790170 TGGGCTGAAGGCCCACCCTGGGG + Intergenic
1063098847 10:2932296-2932318 TGGCTGAAAGGCCAGCCCCTGGG + Intergenic
1063966579 10:11350977-11350999 TGGGTTGGAGGCCCACCCTAGGG - Intergenic
1064061981 10:12145926-12145948 GGGGAGCAAGGCCAGCCCTTAGG + Intronic
1064319951 10:14295686-14295708 TGGGTGGCTGGCTCTCCCTTAGG + Intronic
1069874573 10:71553684-71553706 TAGATGTAAGGCCCGCCCTGAGG + Intronic
1070282723 10:75061681-75061703 GGGGTGGGAGGCCCGGTCTTTGG + Intergenic
1074820291 10:117173477-117173499 TGGGTGGAAGGCGCCCTCTGAGG - Intergenic
1075861715 10:125682963-125682985 TGGGTTGAAGCGTCGCCCTTTGG + Exonic
1077374554 11:2199450-2199472 GGGGAGGATGGCCCGACCTTAGG - Intergenic
1079098457 11:17526323-17526345 TGGGTGGCAGGCATGCCCTGGGG - Intronic
1079328521 11:19514669-19514691 TGGGTGGAAGGCCAGGCTCTGGG + Intronic
1081887648 11:46512675-46512697 TGGGGGGAGGGGCGGCCCTTGGG - Intronic
1084115668 11:67041686-67041708 TTGGTGGAAGCTCTGCCCTTTGG + Intronic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1086300703 11:85423752-85423774 TGGGTGTGAGACCAGCCCTTAGG - Intronic
1088179444 11:107092556-107092578 TGGGAGTAAGACCTGCCCTTTGG + Intergenic
1088368084 11:109059911-109059933 TGGGTGGAAGAGCCGCCTCTGGG - Intergenic
1090802127 11:130179540-130179562 TGGGGTGAAGTCCCGCCCTCAGG + Intronic
1092292315 12:7168871-7168893 TGGGTTGAAGGCACACCCTAGGG + Intergenic
1096424798 12:51492153-51492175 TGGGTGGAAGGCCTGCATCTGGG + Intronic
1098460090 12:70722904-70722926 TGGGTGGAAGGCCCATCTTTTGG - Intronic
1103761140 12:123251159-123251181 TGGGAGTAAGACCGGCCCTTGGG - Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1105633944 13:22199296-22199318 GTGGTGGAAGGCCCGCCCTCAGG + Intergenic
1105892958 13:24695208-24695230 TGGGAGCAAGCCCTGCCCTTTGG + Intronic
1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG + Intronic
1113759452 13:112837304-112837326 TGGGTGAAAGGCCCTTCCTATGG - Intronic
1113887360 13:113667921-113667943 TGGCTGGAAGCCCAGCCCATGGG + Exonic
1115002807 14:28442338-28442360 TGGGTTGAAGGCCTCCCCTTGGG - Intergenic
1119233167 14:72997124-72997146 TGAGTGGAAGGGTCGGCCTTAGG - Intronic
1120771637 14:88385916-88385938 TGAGTGCAAGGCCGCCCCTTGGG + Intronic
1121881883 14:97508136-97508158 AGGGTGGAAGCCCCGGGCTTTGG + Intergenic
1124514278 15:30352975-30352997 TGAGAGGAAGGCCAGCCCCTAGG - Intergenic
1124728641 15:32177789-32177811 TGAGAGGAAGGCCAGCCCCTAGG + Intergenic
1127297778 15:57624912-57624934 AGGGTGGAAGGCCCCCCATGTGG - Intronic
1128389859 15:67175569-67175591 TGGGGGGAGGGTCCTCCCTTTGG - Intronic
1131149496 15:90037977-90037999 TGGCTGGAAGGCCAGGCCTGTGG - Intronic
1131515245 15:93072734-93072756 TGGGTGCGATGCCTGCCCTTGGG - Intronic
1131975714 15:97943787-97943809 TGGATGGAAAACCCACCCTTGGG - Intergenic
1132591221 16:727222-727244 TGGGAGGAAGGCGTGGCCTTTGG + Intronic
1132690532 16:1180120-1180142 TGGATGGACGGCCAGCCCGTTGG + Intronic
1132783317 16:1640811-1640833 TGAGTGGAAGGCCGGCGCTGGGG + Intronic
1132991549 16:2798298-2798320 GTGGTTGAAGACCCGCCCTTAGG + Intergenic
1138250787 16:55500174-55500196 TGGGTGGAAAGCCTGCTCTGTGG - Intronic
1138599361 16:58045880-58045902 TGGGTGGAAGGCTCTTCCTAAGG - Exonic
1139987943 16:70915966-70915988 TGGGAGTAAGACCAGCCCTTTGG - Intronic
1142612466 17:1116764-1116786 TGGGTGGCAGGGCAGCCCCTGGG + Intronic
1144949560 17:18986655-18986677 TGGGTGGAAGGCGAGGCCTCTGG + Intronic
1146845403 17:36178982-36179004 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146873618 17:36390825-36390847 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146880977 17:36441913-36441935 TGGGTGGAGGGCCTGGCCTTTGG + Intergenic
1146946118 17:36874820-36874842 TGGCTGGGAGGCCCATCCTTAGG - Intergenic
1147065770 17:37922048-37922070 TGGGTGGAGGGCCTGGCCTTTGG - Intergenic
1152134410 17:78495361-78495383 TGGGTGGGAGGACCGCACCTGGG - Intronic
1154340349 18:13497705-13497727 TGTGAGGAAAGCCCTCCCTTTGG + Intronic
1156528705 18:37794498-37794520 TGGGTGGCAGGCACTCCCTGAGG - Intergenic
1160010942 18:75106818-75106840 AGTCTGGAAGACCCGCCCTTGGG - Intergenic
1160342415 18:78101257-78101279 TGGATGGAAGTCCGGCCCGTCGG + Intergenic
1160498352 18:79388208-79388230 TGGGTGGGAGGCTGGGCCTTGGG + Intergenic
1161286231 19:3469787-3469809 TGGGGGGCAGGATCGCCCTTGGG - Intergenic
1163364697 19:16869434-16869456 TGGGGGGAAGGGCGGCCATTAGG - Intronic
1166645055 19:44525335-44525357 TGGGTGGAATGCCAGTCCTATGG - Intronic
1168571439 19:57474322-57474344 TGAGTAGAAGGACCTCCCTTGGG + Exonic
1168715166 19:58522802-58522824 AGGGAGGACGGCCCTCCCTTGGG + Intronic
925075231 2:1010813-1010835 TGGGAGGGAGCCCCTCCCTTGGG - Intronic
926789438 2:16555437-16555459 TGGATGGAAGGCCCTGCATTTGG - Intronic
927670224 2:25062765-25062787 TGAGTGTAAGGCCTGCCTTTTGG + Intronic
929583713 2:43100919-43100941 TGGCTGAAAGGCCCGGGCTTGGG - Intergenic
933688043 2:85158779-85158801 TTGGTTGAAGGCCGGCCCTTTGG + Intronic
942997741 2:182285108-182285130 TGGGTGGAAGGCAGGCACTGGGG - Intronic
946044651 2:216810875-216810897 TGTGGGGAAGTCCCGCCCTCTGG + Intergenic
949043957 2:241862186-241862208 TGGGTGGAAGGCACGGGCTTAGG - Intergenic
1169144662 20:3244507-3244529 TAGGTGGAAGGACAACCCTTTGG + Intergenic
1176240128 20:64072074-64072096 TGGGTGGAGAGCCCAGCCTTGGG + Intronic
1179600722 21:42475853-42475875 TGGGGCGAGGGCCCGCACTTAGG - Intronic
1181181650 22:21072868-21072890 TGGGTAGAAGGCTTGCCCATGGG + Intergenic
1181974974 22:26722533-26722555 TGGGTCCCAGGCCCACCCTTTGG - Intergenic
1184681162 22:46072723-46072745 TCTGTGGAAGGCCTGCCCTACGG - Intronic
1184775413 22:46620612-46620634 TGAGTGGAAGCCCCAGCCTTGGG + Intronic
1185345469 22:50308698-50308720 TGGGTGGAAGGCGGGCCCCAGGG - Intergenic
949970116 3:9397242-9397264 CGGGAGGGAGGCCCGCCCTGCGG - Intergenic
950139249 3:10603969-10603991 TGGGTGGCAGGTCTTCCCTTGGG + Intronic
950425108 3:12920957-12920979 TGGGTGTCAGGCCTGCCCTCCGG + Intronic
950796896 3:15517435-15517457 TGTGTGGAAGGCCTGCCCTCCGG + Intronic
951897989 3:27628965-27628987 TGGGTGCTAGGCCTACCCTTCGG - Intergenic
954687658 3:52379394-52379416 TGGGTGGCAGGACTGCCCTCCGG - Intronic
957016421 3:75069625-75069647 TGGGTGTGAGACCAGCCCTTTGG - Intergenic
964743766 3:159992385-159992407 TGGGTGGCAGGCACTCCATTAGG - Intronic
964846693 3:161052032-161052054 TGGTTGGAAGGCCCACTCATTGG + Intronic
966020446 3:175202940-175202962 TGGGTGCAAGACCGGTCCTTTGG - Intronic
966352566 3:179046668-179046690 TGGGAGGAAGACCAGCCTTTAGG + Intronic
966780519 3:183580198-183580220 TGGGTGGCAGGGCCCCCCTGTGG - Intergenic
968441442 4:626490-626512 TGGGAGGGAGGCCCTGCCTTGGG + Intronic
969680539 4:8640886-8640908 TGGGTGGTGGCCCTGCCCTTTGG + Intergenic
985530873 5:433302-433324 TGGGTGGCAGGCAGGCCCTGGGG - Intronic
992340114 5:75814683-75814705 TGGGAGTGAGGCCGGCCCTTTGG - Intergenic
994238447 5:97392460-97392482 TGGGTTGGAGGCCCACCCTGGGG + Intergenic
998141022 5:139699573-139699595 AGGGTGGAAGGCTCTCCCTGTGG + Intergenic
1001310646 5:170607824-170607846 TGGCTGGAAGGCTCCACCTTAGG - Intronic
1001634963 5:173203229-173203251 TGGGCGCAAGGCCCGCTCATAGG - Intergenic
1004224144 6:13770806-13770828 TGGCTGGAAGGCCCAGCCTGGGG - Intergenic
1004308596 6:14523597-14523619 TGAGTGGAAGGGCAGCCCTGTGG - Intergenic
1004401270 6:15290969-15290991 TGTGTGTAAGCCCAGCCCTTTGG + Intronic
1006361586 6:33590117-33590139 TGGTTGGATGGCCGGCCCTGTGG + Intergenic
1018788993 6:167131624-167131646 TGGGTGGAAGGCAGGGGCTTGGG - Intronic
1019869915 7:3751010-3751032 TGGGGGGCAGGCCCACTCTTGGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1024117206 7:46205733-46205755 TGCAGGGAAGGCCTGCCCTTGGG - Intergenic
1032195285 7:129785073-129785095 TGCGTCGAAGGCCGGCTCTTGGG - Intergenic
1034405538 7:150900211-150900233 TGGCTGGACGGCCCTGCCTTAGG - Intergenic
1034414949 7:150959443-150959465 TGGGTGGGGGGTCCCCCCTTTGG - Intronic
1034645871 7:152646702-152646724 TGGGTGGATTGCCCGCGCTCAGG - Exonic
1037987961 8:23301384-23301406 TGGGTGGAAGGCCAGCCCTGAGG - Intronic
1039507467 8:38062262-38062284 TGTGTGGCAGGCCTGGCCTTTGG + Intergenic
1040289830 8:46118588-46118610 CTGGTGGAAGGCCCGCCCAAAGG - Intergenic
1041858302 8:62482695-62482717 TGGTTGGCAGGCCCTCCCTTCGG + Intronic
1053752371 9:41269398-41269420 TGGGTGGGAGGCACGGCCTGGGG - Intergenic
1054257899 9:62833730-62833752 TGGGTGGGAGGCACGGCCTGGGG - Intergenic
1057337480 9:94166746-94166768 CGGGCGGAAGGCCCGCCTTCCGG + Intergenic
1058564660 9:106269466-106269488 TGGGTGGAAGGTACTCCCTGTGG + Intergenic
1062696791 9:137879794-137879816 AAGGTGGAAGGCCAGCCCTGTGG + Intronic
1186234965 X:7498033-7498055 CAGGTGGAAGGCCCACCCTAAGG - Intergenic
1200132935 X:153861360-153861382 TGGGTGGAAGGCCCGGGCTCTGG + Intergenic