ID: 900311430

View in Genome Browser
Species Human (GRCh38)
Location 1:2035330-2035352
Sequence CTCACTCCTCGGATGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900311430_900311436 -10 Left 900311430 1:2035330-2035352 CCAGACCCCATCCGAGGAGTGAG No data
Right 900311436 1:2035343-2035365 GAGGAGTGAGCCTCGGTCACCGG No data
900311430_900311437 -1 Left 900311430 1:2035330-2035352 CCAGACCCCATCCGAGGAGTGAG No data
Right 900311437 1:2035352-2035374 GCCTCGGTCACCGGCTTGTCAGG No data
900311430_900311439 2 Left 900311430 1:2035330-2035352 CCAGACCCCATCCGAGGAGTGAG No data
Right 900311439 1:2035355-2035377 TCGGTCACCGGCTTGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900311430 Original CRISPR CTCACTCCTCGGATGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr