ID: 900312662

View in Genome Browser
Species Human (GRCh38)
Location 1:2041689-2041711
Sequence ACCAGGGCGTGGACTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900312662_900312674 27 Left 900312662 1:2041689-2041711 CCCAGGCCAGTCCACGCCCTGGT No data
Right 900312674 1:2041739-2041761 CCCACCCCATTGCCCCTGCAGGG No data
900312662_900312668 -1 Left 900312662 1:2041689-2041711 CCCAGGCCAGTCCACGCCCTGGT No data
Right 900312668 1:2041711-2041733 TCAGCAGAAGCCTCTGCACCAGG No data
900312662_900312672 26 Left 900312662 1:2041689-2041711 CCCAGGCCAGTCCACGCCCTGGT No data
Right 900312672 1:2041738-2041760 CCCCACCCCATTGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900312662 Original CRISPR ACCAGGGCGTGGACTGGCCT GGG (reversed) Intergenic
No off target data available for this crispr