ID: 900312946

View in Genome Browser
Species Human (GRCh38)
Location 1:2043279-2043301
Sequence TCCACCGCCCTCGGCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900312946_900312961 30 Left 900312946 1:2043279-2043301 CCCAGGGAGCCGAGGGCGGTGGA No data
Right 900312961 1:2043332-2043354 TGGACCCCGCAGCGCAGGAGTGG No data
900312946_900312960 25 Left 900312946 1:2043279-2043301 CCCAGGGAGCCGAGGGCGGTGGA No data
Right 900312960 1:2043327-2043349 ACTGTTGGACCCCGCAGCGCAGG No data
900312946_900312956 10 Left 900312946 1:2043279-2043301 CCCAGGGAGCCGAGGGCGGTGGA No data
Right 900312956 1:2043312-2043334 CACCACCCAGCAGCAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900312946 Original CRISPR TCCACCGCCCTCGGCTCCCT GGG (reversed) Intergenic