ID: 900312966

View in Genome Browser
Species Human (GRCh38)
Location 1:2043338-2043360
Sequence GCCCTGCCACTCCTGCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900312966_900312971 2 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312971 1:2043363-2043385 GTCTGCAGTGCAGGAGTGGCAGG No data
900312966_900312967 -7 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312967 1:2043354-2043376 GCAGGGCCCGTCTGCAGTGCAGG No data
900312966_900312974 24 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312974 1:2043385-2043407 GGCGTGTCCGCGGTGCTGACCGG No data
900312966_900312972 3 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312972 1:2043364-2043386 TCTGCAGTGCAGGAGTGGCAGGG No data
900312966_900312968 -2 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312968 1:2043359-2043381 GCCCGTCTGCAGTGCAGGAGTGG No data
900312966_900312973 14 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312973 1:2043375-2043397 GGAGTGGCAGGGCGTGTCCGCGG No data
900312966_900312975 28 Left 900312966 1:2043338-2043360 CCGCAGCGCAGGAGTGGCAGGGC No data
Right 900312975 1:2043389-2043411 TGTCCGCGGTGCTGACCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900312966 Original CRISPR GCCCTGCCACTCCTGCGCTG CGG (reversed) Intergenic