ID: 900313905

View in Genome Browser
Species Human (GRCh38)
Location 1:2047826-2047848
Sequence CTGGCAGCACAGATCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900313900_900313905 -4 Left 900313900 1:2047807-2047829 CCAGGACGGAGGCTCCCGCCTGG No data
Right 900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG No data
900313897_900313905 10 Left 900313897 1:2047793-2047815 CCTGGGACTGGCTTCCAGGACGG No data
Right 900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG No data
900313896_900313905 11 Left 900313896 1:2047792-2047814 CCCTGGGACTGGCTTCCAGGACG No data
Right 900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG No data
900313894_900313905 17 Left 900313894 1:2047786-2047808 CCACGGCCCTGGGACTGGCTTCC No data
Right 900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900313905 Original CRISPR CTGGCAGCACAGATCTCCCC AGG Intergenic
No off target data available for this crispr