ID: 900314703

View in Genome Browser
Species Human (GRCh38)
Location 1:2050900-2050922
Sequence CCCCGGGACCGGGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900314689_900314703 24 Left 900314689 1:2050853-2050875 CCCGTGAGCGTCACCCGCGGACA 0: 1
1: 0
2: 0
3: 1
4: 19
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314686_900314703 28 Left 900314686 1:2050849-2050871 CCCGCCCGTGAGCGTCACCCGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314690_900314703 23 Left 900314690 1:2050854-2050876 CCGTGAGCGTCACCCGCGGACAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314693_900314703 10 Left 900314693 1:2050867-2050889 CCGCGGACACGTCGTGGACAGCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314687_900314703 27 Left 900314687 1:2050850-2050872 CCGCCCGTGAGCGTCACCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314692_900314703 11 Left 900314692 1:2050866-2050888 CCCGCGGACACGTCGTGGACAGC 0: 1
1: 0
2: 0
3: 3
4: 21
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74
900314685_900314703 29 Left 900314685 1:2050848-2050870 CCCCGCCCGTGAGCGTCACCCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900314703 Original CRISPR CCCCGGGACCGGGTTTCCCT GGG Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900793949 1:4696406-4696428 CCCAGGGACAGGGCTCCCCTAGG - Intronic
901895047 1:12304578-12304600 CCCTGGGAATGGGTTCCCCTGGG - Exonic
905791371 1:40791492-40791514 CCCAGGGACAGGGTTGCCCAGGG - Intronic
906476186 1:46171199-46171221 CCCTAGGACTGGGCTTCCCTGGG - Intronic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
1063592567 10:7408211-7408233 TCCCGGGGCCGGCTTTCCCATGG - Intronic
1063623030 10:7666770-7666792 GCCCGGGACCCGGCTCCCCTCGG + Intronic
1075265838 10:120999131-120999153 CCCTGGCAGTGGGTTTCCCTTGG + Intergenic
1076065515 10:127444828-127444850 GCCCGGGACAGGCTCTCCCTTGG - Intronic
1077106168 11:843482-843504 CCCCGGCACAGGGGATCCCTGGG + Intronic
1077282220 11:1750939-1750961 CACCGGGTCCAGTTTTCCCTGGG - Intronic
1079132019 11:17752341-17752363 CATCGGGACCTGGTTTCCCAGGG - Intronic
1083792660 11:64995912-64995934 CCCTGGGCCATGGTTTCCCTTGG - Intronic
1088583193 11:111334895-111334917 CCCGGGGACTGGGTTTCCACTGG - Intergenic
1089286805 11:117412611-117412633 CCCTGGGACCCGATTTCTCTGGG + Exonic
1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG + Exonic
1092032047 12:5294439-5294461 CCCGGGGTCCGGGTAACCCTGGG + Intergenic
1122885702 14:104709429-104709451 CCCCGGGACAGCCTCTCCCTTGG - Intronic
1123065709 14:105618210-105618232 CGCCTGGACCAGGTTCCCCTAGG - Intergenic
1123069872 14:105637455-105637477 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1123089106 14:105734243-105734265 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1123094893 14:105762400-105762422 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1127396294 15:58546255-58546277 CCCCGGGAGAGGGTTTGCCTGGG - Intronic
1131182424 15:90249698-90249720 CCCCGGCTCCAGGTCTCCCTGGG - Exonic
1132593223 16:735581-735603 CCCCAGGCCAGGTTTTCCCTGGG + Intronic
1134803480 16:17106326-17106348 CCTCTGGCCAGGGTTTCCCTGGG - Exonic
1136367689 16:29816446-29816468 CCCAGGGATCGGGCTCCCCTGGG - Exonic
1137788633 16:51155800-51155822 CCCCGGGACCTTGCTTCCCCGGG + Intergenic
1139548357 16:67660245-67660267 CAACGGGCCCGGGTTTCCCGCGG + Exonic
1141443675 16:84044955-84044977 CCCGGGGACTGGGGTTCCCTAGG + Intergenic
1141509920 16:84505361-84505383 CCCCGGGACCAGGTTTCGGTGGG - Intronic
1143106208 17:4531737-4531759 CCCCGGGACTGGGAGCCCCTGGG - Intronic
1147158579 17:38558155-38558177 ACCCGCAACCTGGTTTCCCTGGG - Intronic
1148685057 17:49496350-49496372 CCCCGGGAGCGGGTTCGCCCCGG - Intronic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1161867762 19:6847284-6847306 GCCCGGGATGGGGTTTCTCTTGG - Intronic
1162376499 19:10308445-10308467 CCCCAGGACCGGGGTGTCCTGGG + Exonic
1165266720 19:34667413-34667435 CCCCGGGCCCAGGTTCTCCTGGG - Intronic
1165443853 19:35845920-35845942 CCCCGGGTCCAGGGTTCGCTGGG + Intronic
1167002696 19:46755541-46755563 CCCCGGGCCCGGGAATTCCTAGG - Exonic
1167311865 19:48741609-48741631 CCCGAGGACAGGGGTTCCCTTGG - Intronic
925669568 2:6296787-6296809 CCCCAGGACCCTGTTTCTCTAGG - Intergenic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
932496247 2:72147298-72147320 CCCCGGGACCGCGCCTCGCTAGG + Intronic
938583976 2:132670919-132670941 CCCCGGGACGGCGTTCTCCTAGG - Intronic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
947708135 2:232292916-232292938 CCCCAGGAACAGGCTTCCCTGGG - Intronic
948653320 2:239462453-239462475 CCCCGGTTCCGGAGTTCCCTGGG - Intergenic
1169068530 20:2707830-2707852 CCCTGGGGCAGGGTCTCCCTGGG + Intronic
1171215543 20:23350037-23350059 AGCCGGGCCCGGGTTTCCCGGGG + Intergenic
1172117883 20:32583049-32583071 CGCCGGGACCGGGCTCCCCGAGG - Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1181064442 22:20299006-20299028 CCCGGGGACCGGGTCTCTCGCGG + Intergenic
1181592140 22:23892018-23892040 CACAGGGACCGGGTTACCCCAGG + Intronic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
950265577 3:11570443-11570465 GCCAGGGACCGGGGTCCCCTGGG - Intronic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
968945399 4:3661012-3661034 CCCTGAGACAGCGTTTCCCTGGG - Intergenic
968977236 4:3828296-3828318 CCCCAGGACCTAGTTTCCCAAGG + Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
985766264 5:1781318-1781340 CCCTGGGACCTGGTTTCACAAGG + Intergenic
997654535 5:135545396-135545418 CACAGGGGCCTGGTTTCCCTGGG - Intergenic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
998176324 5:139904266-139904288 CCCAGAAACCCGGTTTCCCTGGG - Intronic
999341676 5:150778716-150778738 CCCCGGGACCGGGCGTTCCGGGG + Exonic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1006443507 6:34066200-34066222 CCACGTGCCGGGGTTTCCCTGGG - Intronic
1019737644 7:2658604-2658626 CCCCTGGACCGTGTTCACCTGGG - Intronic
1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG + Intronic
1032101640 7:128983874-128983896 CCTCGAGACTGGGTTTCCCTGGG + Intronic
1034827102 7:154275445-154275467 CCCCGAGACCTGGTGTCCATAGG - Intronic
1035171152 7:157018090-157018112 CCCCGGGACCGTCTGTCCCTAGG - Intergenic
1036204373 8:6794376-6794398 CCCAGGGACCGGGGTTCCCAAGG + Intergenic
1036999907 8:13705664-13705686 CCCCAGGTCCAGGTTTCCCTGGG + Intergenic
1049285446 8:141772611-141772633 CCCAGGGACATGGTTCCCCTGGG - Intergenic
1060524936 9:124315199-124315221 CCCAGGAAGCGGGTTTCCCTGGG - Intronic
1062047529 9:134431410-134431432 CCCCAGGGCCTGGTGTCCCTGGG - Intronic
1062277203 9:135736664-135736686 CCCCGGGCCCGCCTTGCCCTCGG - Intronic
1062376754 9:136265283-136265305 CCCCAGCACCGACTTTCCCTGGG + Intergenic
1062485864 9:136775318-136775340 CCCCGAGACCGGCTCTGCCTGGG - Intergenic
1062510412 9:136902286-136902308 CCCAGGGTCAGGGTCTCCCTGGG + Intronic
1186655342 X:11605912-11605934 CCCCGGGATGGGGTTGCTCTTGG - Intronic
1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG + Intergenic
1192035234 X:67555802-67555824 CCCCGTGGCAGGATTTCCCTGGG + Intronic