ID: 900314705

View in Genome Browser
Species Human (GRCh38)
Location 1:2050901-2050923
Sequence CCCGGGACCGGGTTTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900314685_900314705 30 Left 900314685 1:2050848-2050870 CCCCGCCCGTGAGCGTCACCCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314692_900314705 12 Left 900314692 1:2050866-2050888 CCCGCGGACACGTCGTGGACAGC 0: 1
1: 0
2: 0
3: 3
4: 21
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314693_900314705 11 Left 900314693 1:2050867-2050889 CCGCGGACACGTCGTGGACAGCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314687_900314705 28 Left 900314687 1:2050850-2050872 CCGCCCGTGAGCGTCACCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314690_900314705 24 Left 900314690 1:2050854-2050876 CCGTGAGCGTCACCCGCGGACAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314686_900314705 29 Left 900314686 1:2050849-2050871 CCCGCCCGTGAGCGTCACCCGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314689_900314705 25 Left 900314689 1:2050853-2050875 CCCGTGAGCGTCACCCGCGGACA 0: 1
1: 0
2: 0
3: 1
4: 19
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900314705 Original CRISPR CCCGGGACCGGGTTTCCCTG GGG Intronic
900002865 1:24630-24652 CCCAGGACCGGGATTCCCCAAGG + Intergenic
900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG + Intronic
900333859 1:2151009-2151031 CCCGGGAACGCGCTGCCCTGGGG + Intronic
900532635 1:3162225-3162247 CCGGGCACGGGGTTTTCCTGGGG - Intronic
901738936 1:11329784-11329806 CTGGGGACTGGGTGTCCCTGGGG + Intergenic
902715932 1:18272699-18272721 CCAGGGACCTGGCTGCCCTGGGG + Intronic
906295042 1:44644573-44644595 CCCAGGCCCAGGTTTCCCTCTGG + Intronic
910221439 1:84893042-84893064 CCCGGGAGCGGGGGCCCCTGCGG + Intronic
916673556 1:167046579-167046601 CCAGGGTCAGGGTCTCCCTGAGG + Intergenic
920674930 1:208032048-208032070 CCCGGGTCCGGGCTTCCCATGGG + Intronic
923215568 1:231845310-231845332 CTCTGGACCGGGTTTGGCTGTGG + Intronic
1063592565 10:7408210-7408232 CCCGGGGCCGGCTTTCCCATGGG - Intronic
1067112195 10:43408653-43408675 GCGGGGACCGGGTCCCCCTGGGG - Intronic
1069771825 10:70905305-70905327 CCCGGGAGCAGGTTTCCGAGAGG + Intergenic
1070681663 10:78453237-78453259 CCCATGTCTGGGTTTCCCTGAGG - Intergenic
1073108532 10:101047397-101047419 CCGGAGACCGGGCTTCTCTGCGG - Intergenic
1073889975 10:108090395-108090417 CACAGTACAGGGTTTCCCTGAGG + Intergenic
1078119392 11:8490785-8490807 CTCCAGACCGTGTTTCCCTGGGG - Intronic
1081969203 11:47186455-47186477 CCGGGGGCCGGGCTTCCCGGGGG - Intergenic
1085732958 11:79014733-79014755 CCCAGAACCGGCTTTCTCTGTGG - Intronic
1092682073 12:10994308-10994330 CACTGGCCAGGGTTTCCCTGAGG - Intronic
1099035351 12:77580311-77580333 CCCAGGACAGAATTTCCCTGTGG + Intergenic
1102571870 12:113831725-113831747 CCCGGGAGCGGCTGTCCGTGTGG - Intronic
1103996536 12:124833862-124833884 CCCCGGCCCGGGTTTCTCTTAGG - Intronic
1104945943 12:132414928-132414950 GCCAGGACCCAGTTTCCCTGAGG + Intergenic
1108598952 13:51974153-51974175 CCCTGGACCTGGTTTCTCGGTGG + Exonic
1112054502 13:95677489-95677511 CCCGGTTCCGGGTTTGTCTGGGG + Intronic
1112344432 13:98577483-98577505 CCCGGGACGCGTTTTCCCAGAGG - Intronic
1118607530 14:67514841-67514863 CCCGGGGCTTGGATTCCCTGCGG - Intronic
1121509579 14:94502361-94502383 CACGAGAAGGGGTTTCCCTGTGG + Intronic
1121558529 14:94856961-94856983 AGCAGGTCCGGGTTTCCCTGGGG + Intergenic
1122902848 14:104788920-104788942 CACGGGACCGTGTGTCCATGCGG - Intronic
1122922560 14:104886034-104886056 CCCGGCACCGGGAGGCCCTGTGG - Exonic
1122922566 14:104886045-104886067 CCCGGTGCCGGGCTCCCCTGGGG + Exonic
1123069871 14:105637454-105637476 GCCTGGACCAGGTTCCCCTGGGG - Intergenic
1123089105 14:105734242-105734264 GCCTGGACCAGGTTCCCCTGGGG - Intergenic
1123094892 14:105762399-105762421 GCCTGGACCAGGTTCCCCTGGGG - Intergenic
1124396687 15:29308473-29308495 CCCAGGACAGGGTCTCCCTGTGG - Intronic
1132450647 15:101966309-101966331 CCCAGGACCGGGATTCCCCAAGG - Intergenic
1132688732 16:1172944-1172966 GCAGGGACCTGGTGTCCCTGGGG - Intronic
1133341996 16:5042681-5042703 CCCGGGACCGGGTTTTCAGCTGG + Intronic
1134803479 16:17106325-17106347 CTCTGGCCAGGGTTTCCCTGGGG - Exonic
1136367687 16:29816445-29816467 CCAGGGATCGGGCTCCCCTGGGG - Exonic
1138358828 16:56408814-56408836 CCCTGGAGCGGGTTTAACTGAGG + Intronic
1141199173 16:81883820-81883842 CCCTGGACAGGGTTTGCCTGTGG + Intronic
1141511681 16:84516248-84516270 CCCTGCACCAAGTTTCCCTGTGG + Intronic
1142291037 16:89193637-89193659 CCCGCGACCTGGGTTCCTTGGGG - Intronic
1143757379 17:9076859-9076881 CCCAGGATGGGGTGTCCCTGAGG + Intronic
1145250599 17:21295017-21295039 CCAGTGACCGGCTCTCCCTGTGG - Intronic
1148559384 17:48597271-48597293 TCTGGGACTGTGTTTCCCTGTGG - Intronic
1148845226 17:50526090-50526112 TCTGGGACCCGGATTCCCTGAGG - Exonic
1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG + Exonic
1151959585 17:77398592-77398614 GCCGGGACATGGTTTCCTTGGGG + Intronic
1152400941 17:80065727-80065749 CCCGGGTCCGGGCTTCCGTCCGG + Intronic
1152654880 17:81514822-81514844 CCCCGGGCCGGGCTTCCCGGCGG - Intronic
1157607712 18:48936457-48936479 CATGGGACCGGGTTTCCTTTTGG - Intronic
1160634616 19:66238-66260 CCCAGGACCGGGATTCCCCAAGG + Intergenic
1160662319 19:306833-306855 GCCGGGCCCGGGGTGCCCTGAGG + Intronic
1161739920 19:6014717-6014739 CCAGAGACCAGGCTTCCCTGTGG + Intronic
1161867760 19:6847283-6847305 CCCGGGATGGGGTTTCTCTTGGG - Intronic
1167501663 19:49851628-49851650 CCCGGGGCCGGGTTCCCCCGTGG + Intronic
1167770065 19:51509344-51509366 CCCCTGACTGGGTTTCCCTGAGG + Intergenic
1168703760 19:58456492-58456514 CCCGGGGCCAGGTTTCCTTCAGG + Exonic
928313795 2:30231343-30231365 CCCGGGGCCGTGGTTCGCTGCGG - Intergenic
929933646 2:46277568-46277590 CCCGGGACAAGGATTTCCTGTGG + Intergenic
931794975 2:65700413-65700435 CGCGGCACCGGGTATCCCCGTGG - Intergenic
936566861 2:113588789-113588811 CCCAGGACCGGGATTCCCCAAGG - Intergenic
939441829 2:142260275-142260297 CCCTGGACCAGGTCTCCCTCTGG + Intergenic
945066253 2:205949847-205949869 CCCTGGGCCAGGCTTCCCTGGGG - Intergenic
948519343 2:238525534-238525556 CGTGGGACGGGCTTTCCCTGAGG - Intergenic
949079926 2:242088640-242088662 CCAGGGGCGGGGCTTCCCTGAGG + Intergenic
1168832072 20:851471-851493 CTGGGGAGCGGGTTTCCCAGAGG + Intronic
1170809873 20:19665708-19665730 CCTGGGACCTGGAGTCCCTGTGG - Intronic
1173625252 20:44467623-44467645 CCCGGGCCTGGGGTTCCCTAAGG - Intergenic
1175408775 20:58752472-58752494 CCCAGGCCTGGGTATCCCTGTGG - Intergenic
1175944772 20:62553596-62553618 CCCGGGACCCCGTATCCATGAGG - Exonic
1176448517 21:6841818-6841840 CCAGGGACTCTGTTTCCCTGTGG + Intergenic
1176826687 21:13706840-13706862 CCAGGGACTCTGTTTCCCTGTGG + Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1181339178 22:22164920-22164942 CCCAAGACCTGGTTCCCCTGTGG - Intergenic
1184113676 22:42409790-42409812 CCCGTGACCTGGCTCCCCTGTGG + Intronic
1184697836 22:46149991-46150013 CCCGGGACCGGGTGCCCTTGAGG - Intergenic
1185086934 22:48745962-48745984 CCCGGGACAGTGTGCCCCTGCGG - Intronic
952901482 3:38114593-38114615 TCCAGGCCAGGGTTTCCCTGGGG + Intronic
953269998 3:41432394-41432416 TTCGGGACTGGTTTTCCCTGTGG - Intronic
954082781 3:48222244-48222266 CCTGGCCTCGGGTTTCCCTGGGG - Intergenic
954108317 3:48420806-48420828 CCCAGGCCTGGGCTTCCCTGTGG - Intronic
954177014 3:48852687-48852709 CCCAGGGCCAGGTGTCCCTGAGG - Intergenic
954208206 3:49076313-49076335 GCCGGGACCGGGTTCCGGTGTGG + Intronic
959909495 3:111747920-111747942 CCCTGGACCCTGATTCCCTGTGG + Intronic
964722568 3:159781818-159781840 CCCAGGACAGGGCTTCTCTGTGG + Intronic
965433718 3:168620977-168620999 CCCAGGACAGGTTTTCCCAGTGG + Intergenic
968131075 3:196193180-196193202 GCTGGGTGCGGGTTTCCCTGTGG - Intergenic
968915500 4:3495472-3495494 CCCTGGACAGCCTTTCCCTGTGG + Intronic
968945397 4:3661011-3661033 CCTGAGACAGCGTTTCCCTGGGG - Intergenic
976178186 4:82374587-82374609 CCCGGGACCGGGTGACATTGAGG + Intergenic
981575722 4:146202974-146202996 ACCTGGACAGGGGTTCCCTGTGG - Intergenic
985213909 4:187628854-187628876 CCCAGCACTGGGTTTCTCTGGGG - Intergenic
985548940 5:523766-523788 CCCGGGGCCGGGTTTCCTTCGGG - Intronic
985559197 5:573984-574006 CCCAGGCCCGGCTCTCCCTGGGG - Intergenic
999302643 5:150500676-150500698 CCCAGGCCAGGCTTTCCCTGTGG - Intronic
999341678 5:150778717-150778739 CCCGGGACCGGGCGTTCCGGGGG + Exonic
1002189977 5:177473133-177473155 CCCGGGGCCGCGTGGCCCTGCGG - Exonic
1006443506 6:34066199-34066221 CACGTGCCGGGGTTTCCCTGGGG - Intronic
1007750247 6:44066862-44066884 CCTCGGACTGGGGTTCCCTGTGG + Intergenic
1008894995 6:56542727-56542749 CCCGGCACCGTGCTGCCCTGAGG - Intronic
1013751224 6:113408892-113408914 CCAAGGACCCGATTTCCCTGTGG + Intergenic
1013847258 6:114467981-114468003 CCCGGTACCCTATTTCCCTGAGG - Intergenic
1016334594 6:142991008-142991030 CCTGGGACCGAGGTTCCCTGTGG - Intergenic
1019399502 7:844180-844202 GGCGGGACTGGGATTCCCTGGGG + Intronic
1019737642 7:2658603-2658625 CCCTGGACCGTGTTCACCTGGGG - Intronic
1020241616 7:6399536-6399558 CCCGGGAGCGAGTTCTCCTGAGG + Intronic
1021844652 7:24752664-24752686 CATGGGACTGGGTCTCCCTGAGG + Intronic
1024467500 7:49727953-49727975 CCAAGGACCGGATTTCCCTGTGG - Intergenic
1026889288 7:73972820-73972842 CCCCGGAGCAGGCTTCCCTGGGG - Intergenic
1027054194 7:75038867-75038889 CCCGAGACTGGGTTTCCCCCCGG - Intronic
1029110545 7:98211353-98211375 CCGGGGTCCGGGTGTCCCGGCGG - Intergenic
1034979762 7:155468160-155468182 GCCGGGACCCGGTAGCCCTGAGG + Intergenic
1035233044 7:157477745-157477767 GCAGGCACCGGGTTTCCCAGAGG + Intergenic
1035537962 8:406905-406927 CCAGGGGCGGGGCTTCCCTGAGG + Intronic
1038180196 8:25220566-25220588 ACAGGTACCGGGTGTCCCTGAGG + Intronic
1039900175 8:41746109-41746131 CCCATCAGCGGGTTTCCCTGTGG - Intronic
1040901054 8:52417461-52417483 CCCGGGACTTAGCTTCCCTGTGG - Intronic
1049223105 8:141436846-141436868 CCCTGGAGCAGGCTTCCCTGGGG + Intergenic
1049559898 8:143304740-143304762 CCCGGGTCCTGGCCTCCCTGGGG + Intronic
1049606089 8:143529834-143529856 CCCGAGTCCGAGTTTCTCTGAGG - Intronic
1049624175 8:143612718-143612740 CCGGGACCCTGGTTTCCCTGAGG + Exonic
1049656980 8:143803345-143803367 CCGGGGACCGGGCCTCCCTCTGG - Intronic
1049747626 8:144269732-144269754 CCCGGGCCCTGGCTTCCCGGCGG - Intronic
1049885670 9:24743-24765 CCCAGGACCGGGATTCCCCAAGG + Intergenic
1054800621 9:69344784-69344806 CAAGGGACCTGGTTTTCCTGTGG + Intronic
1060524934 9:124315198-124315220 CCAGGAAGCGGGTTTCCCTGGGG - Intronic
1061780968 9:132995895-132995917 CCCTGGGCCTGGTTGCCCTGTGG - Intergenic
1062284959 9:135768720-135768742 CCGGGGAGCGGGGGTCCCTGAGG + Intronic
1062376756 9:136265284-136265306 CCCAGCACCGACTTTCCCTGGGG + Intergenic
1203520674 Un_GL000213v1:42700-42722 CCAGGGACTCTGTTTCCCTGTGG - Intergenic
1203655515 Un_KI270752v1:20565-20587 TTCGAGACAGGGTTTCCCTGTGG + Intergenic
1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG + Intronic
1189356554 X:40314058-40314080 CCCTTGACCGGGGATCCCTGTGG + Intergenic
1191716464 X:64197103-64197125 GCTGGGACTGGCTTTCCCTGGGG + Intronic
1197293092 X:124684486-124684508 CCTGGCACCAGGGTTCCCTGGGG - Intronic