ID: 900314705

View in Genome Browser
Species Human (GRCh38)
Location 1:2050901-2050923
Sequence CCCGGGACCGGGTTTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900314687_900314705 28 Left 900314687 1:2050850-2050872 CCGCCCGTGAGCGTCACCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314689_900314705 25 Left 900314689 1:2050853-2050875 CCCGTGAGCGTCACCCGCGGACA 0: 1
1: 0
2: 0
3: 1
4: 19
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314686_900314705 29 Left 900314686 1:2050849-2050871 CCCGCCCGTGAGCGTCACCCGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314685_900314705 30 Left 900314685 1:2050848-2050870 CCCCGCCCGTGAGCGTCACCCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314693_900314705 11 Left 900314693 1:2050867-2050889 CCGCGGACACGTCGTGGACAGCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314690_900314705 24 Left 900314690 1:2050854-2050876 CCGTGAGCGTCACCCGCGGACAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131
900314692_900314705 12 Left 900314692 1:2050866-2050888 CCCGCGGACACGTCGTGGACAGC 0: 1
1: 0
2: 0
3: 3
4: 21
Right 900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900314705 Original CRISPR CCCGGGACCGGGTTTCCCTG GGG Intronic