ID: 900315782

View in Genome Browser
Species Human (GRCh38)
Location 1:2055704-2055726
Sequence CAGTGGGGATGGTGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 1, 1: 0, 2: 7, 3: 106, 4: 1099}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900315782 Original CRISPR CAGTGGGGATGGTGGGAAAG AGG Intronic
900137610 1:1125020-1125042 CAGGAGGGATGTGGGGAAAGGGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900438177 1:2641173-2641195 CTGTGGGGAGGGTTGGGAAGGGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900934216 1:5755226-5755248 AAGTGGGGATGGCTGGGAAGGGG + Intergenic
901185338 1:7369132-7369154 CAGTGAGGATGGTCTGAAGGGGG + Intronic
901653248 1:10755116-10755138 CAGTGGTGTGGGTGGGAACGTGG + Intronic
902254215 1:15177067-15177089 TAGTGGGGATTGTGGCAAAGTGG + Intronic
902519854 1:17010088-17010110 CAGGGGGGAAGGGGGGAACGGGG - Intronic
902609413 1:17588354-17588376 CCCTGGGGAGGCTGGGAAAGGGG + Intronic
902864363 1:19268707-19268729 CAGTGGGGATGGTGGCACAGGGG + Intergenic
903173813 1:21569124-21569146 CCGTGGGGATGGTGGGGGTGTGG + Intronic
903269542 1:22178734-22178756 CAGAGGAGATGGTGGGGAACAGG - Intergenic
903646470 1:24899070-24899092 CAGTGGGGATTGGGAGTAAGCGG - Intergenic
903774654 1:25785106-25785128 CATCAGGGAGGGTGGGAAAGGGG - Exonic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904041681 1:27589021-27589043 CAGTGGGGAAGGTAGGTAAGAGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904393030 1:30198177-30198199 CAGAGGGGAGGGGGGGAGAGAGG + Intergenic
904617284 1:31756647-31756669 CCGAGGCGATGGTAGGAAAGAGG + Exonic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
904898515 1:33836876-33836898 CACTGGGGATTGTCGGAGAGTGG - Intronic
905885674 1:41490627-41490649 TGGTGGTGATGGTGGGATAGAGG - Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906613918 1:47222237-47222259 AAGGGGAGATGGTGGGGAAGTGG + Intronic
906658996 1:47569169-47569191 CAGTGCAGATGGTGGGAGTGAGG + Intergenic
906701248 1:47859692-47859714 AGGTGGAGATGGTGGGGAAGTGG - Intronic
906781080 1:48573282-48573304 CAGTAGGGAGAGTGGGAAACTGG + Intronic
907115688 1:51966470-51966492 CAGTTTGGATGGAAGGAAAGGGG + Intronic
907514864 1:54987271-54987293 TAGTGGACATGGTGGAAAAGAGG + Intronic
907587996 1:55638640-55638662 CATGGGGGATGGTGGGAGTGAGG - Intergenic
907676440 1:56521850-56521872 CTGTGGGGATGATGGGTGAGAGG - Intronic
908047644 1:60187794-60187816 CACTGGGGATTGTCGGACAGTGG - Intergenic
908550697 1:65206150-65206172 CACTGGGGGTGGAGGGATAGGGG - Intronic
908611518 1:65865887-65865909 GAGTTGGGATGGAGGGAGAGAGG - Intronic
908913786 1:69102543-69102565 CACTGGGGCTTGTTGGAAAGTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909585144 1:77281529-77281551 CTGTGGGGAAGGGGGAAAAGGGG - Intergenic
909715426 1:78701872-78701894 CAGAGGTGCTGGTGGGCAAGGGG + Intergenic
910053664 1:83006381-83006403 CAGTGGGCATTGCTGGAAAGAGG + Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910589332 1:88912772-88912794 TAGTGAGGATGCAGGGAAAGGGG - Intergenic
910846793 1:91611914-91611936 CAGTGTGGATGGGGGCAAGGAGG + Intergenic
910993072 1:93075912-93075934 CAGTGAGGATATTGGGAAACTGG + Intergenic
911074057 1:93855846-93855868 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
911396065 1:97311932-97311954 GAGTAGGGATGGTGTTAAAGTGG + Intronic
911739712 1:101374083-101374105 CAGTGTAAATGGTGGGATAGTGG - Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912614102 1:111079520-111079542 CACTGGGGCTTGTGGGACAGTGG - Intergenic
912633207 1:111267276-111267298 CAGTGGTGATGGTGGCCATGGGG - Intergenic
913081284 1:115389344-115389366 CACTGGGGCTGGTTGGACAGTGG - Intergenic
913162711 1:116159502-116159524 CAGAGGTGACGTTGGGAAAGGGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913284954 1:117217708-117217730 CACTGGGGATTGTTGGACAGTGG + Intergenic
913438005 1:118867281-118867303 TTGTGGGGGTGGTGGTAAAGAGG - Intergenic
913963299 1:143355120-143355142 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
914057655 1:144180706-144180728 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
914121491 1:144785660-144785682 CAGAGGGGCAGGTGGGAGAGTGG + Intergenic
914216649 1:145636848-145636870 CAGGGGGGGTGGTGGCTAAGGGG - Intronic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
915312501 1:155011549-155011571 CTGGGGGGGTGGCGGGAAAGAGG + Intronic
915484731 1:156212298-156212320 CAGTGGGGAAGGTGTCAATGGGG + Exonic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
915900854 1:159845763-159845785 CAGTGGATGTGGTGGGAGAGTGG + Intronic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
916492622 1:165315303-165315325 TAGTGTGGATGTTGGGAGAGGGG - Intronic
916613609 1:166417302-166417324 CACTGGGGATTGTTGGACAGTGG - Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917205191 1:172564208-172564230 CAGTGGGGATGCTGGGGATTGGG - Intronic
917207957 1:172597286-172597308 CAGTGGGGCTTGTTGGACAGTGG - Intronic
917252089 1:173074062-173074084 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
917585067 1:176417475-176417497 CATTGGGAATGGTTGGACAGTGG - Intergenic
917832514 1:178908078-178908100 GAGTGGGGAGGGTGGGAGAGGGG - Intronic
918239571 1:182609782-182609804 GAGGAGGTATGGTGGGAAAGAGG - Intergenic
918270525 1:182893878-182893900 TAGTGGTGGTGGTAGGAAAGTGG + Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918354114 1:183689762-183689784 AAGTAGGGGTGGTGGGACAGAGG + Intronic
918408597 1:184235254-184235276 CACTGGGGATTGTCGGACAGTGG - Intergenic
919041380 1:192392609-192392631 AAGTGGGGAGGGAGGGACAGAGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919796798 1:201325672-201325694 CAGTGGGGGTGGGAGGGAAGAGG + Intronic
919856405 1:201709247-201709269 CACAGGAGATGGTGAGAAAGGGG + Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920095245 1:203482565-203482587 CATTGGGGCTGGTGGGACAGTGG - Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920312057 1:205054357-205054379 CAGTGAGGCTGCTGGGAAACAGG + Intronic
920323715 1:205144767-205144789 CAGTGGGGAGGGTGGAAGGGAGG - Exonic
920509268 1:206538627-206538649 CAGTGGGGATGCTGGGGCTGAGG + Intronic
920557826 1:206917056-206917078 CAGTGGTTATGGTAGGGAAGAGG + Intronic
920589821 1:207206848-207206870 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
920642459 1:207766132-207766154 AAGTGGGGATGAGGGGGAAGAGG + Intronic
920773899 1:208916967-208916989 CAGTGAGGAGTGTGGGAAAGTGG - Intergenic
920847844 1:209608432-209608454 GAGGAGGGATGGTGGGGAAGAGG - Intronic
920983796 1:210864281-210864303 CAGTGAGGATGTGGGGAATGAGG + Intronic
921243664 1:213214004-213214026 CACTGGGGATTGTCGGACAGTGG + Intronic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921409753 1:214823255-214823277 CAGTGGAGGTGGTGGGAGGGGGG + Intergenic
922455465 1:225770490-225770512 CGGTAGGGAAGGTGGGAAAGGGG - Intergenic
922826746 1:228526700-228526722 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
922962956 1:229663794-229663816 CAGTGGTCATGGTGGCAACGGGG - Intergenic
922978067 1:229801562-229801584 CAGAGTGGATGGAGGGACAGTGG + Intergenic
923672480 1:236052503-236052525 CAGCGTGGGTGGTGAGAAAGAGG - Intronic
924411143 1:243807161-243807183 CAATGGGGATTGTCGGACAGTGG + Intronic
924874435 1:248085754-248085776 CAATGGGGGTTGTGGGAGAGGGG + Intronic
1063416205 10:5874490-5874512 CAGTAGGGATGGTGTGGAACAGG + Intronic
1063953682 10:11247008-11247030 TTGTGGGGATGGTGGAGAAGGGG - Intronic
1064058436 10:12117345-12117367 CAGTGGGGATGGTGGAGTAGGGG + Intronic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064602477 10:17007620-17007642 CAGTGGGGAGGGTGGGGCAGGGG + Intronic
1065157524 10:22885765-22885787 CACTGGGGATTGTTGGACAGGGG + Intergenic
1065237893 10:23672427-23672449 CACTGGGGATTGTTGGACAGTGG - Intergenic
1065898290 10:30183380-30183402 TAGTGAGGATGGGGAGAAAGAGG + Intergenic
1066028676 10:31394044-31394066 GAGGAGTGATGGTGGGAAAGTGG + Intronic
1066139422 10:32488498-32488520 CACTGGGGAGTGTCGGAAAGTGG - Intronic
1066402661 10:35090492-35090514 CGGTAGGGAGGGGGGGAAAGGGG + Intronic
1066584227 10:36914051-36914073 CACTGGGGCTTGTGGGACAGTGG - Intergenic
1067005529 10:42657339-42657361 AAGGGGGGAGGGTGGGAAGGGGG - Intergenic
1067101852 10:43339712-43339734 CAGAGGGGCTGGTGGGGCAGGGG + Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1067274242 10:44820173-44820195 GAGTGGGGAGGGTGGGTGAGGGG - Intergenic
1067339254 10:45387929-45387951 CACTGGGGATTGTTGGACAGTGG + Intronic
1067549116 10:47221088-47221110 CAGTGTGGATTGATGGAAAGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067810767 10:49425631-49425653 CACTGGGGATTGTCGGACAGTGG - Intergenic
1067955722 10:50788452-50788474 CACTGGGGAATGTCGGAAAGTGG - Intronic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068309113 10:55256352-55256374 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1069256390 10:66336244-66336266 CACTGGGGATTGTCGGACAGTGG - Intronic
1069883152 10:71606739-71606761 CAGGGGTGAGGGTGGGAAGGTGG + Intronic
1069899816 10:71701038-71701060 CAGTGGTGGTGGGGGGAGAGAGG - Intronic
1070195413 10:74151696-74151718 CCCGGGGGATGGCGGGAAAGAGG + Intronic
1070594545 10:77823158-77823180 GAGTGGGGATGGTGGTGATGGGG + Intronic
1070650320 10:78230667-78230689 CAGTGGTGTTGGTGGCAGAGAGG - Intergenic
1071000993 10:80830273-80830295 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1071005636 10:80881580-80881602 CAGTGGGGAGTGTTGAAAAGTGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1071698539 10:87903854-87903876 CACTGGGACTGGTTGGAAAGTGG - Intronic
1071966821 10:90859776-90859798 CACTGGGGATCTTGGGAGAGAGG + Intergenic
1071999251 10:91177926-91177948 CACTGGGGATTGTTGGACAGTGG - Intronic
1072054683 10:91742919-91742941 CGATGGGGAGTGTGGGAAAGGGG - Intergenic
1072108614 10:92297042-92297064 CATTGGGGATGGTGGTCAAAGGG - Intronic
1072388827 10:94960630-94960652 CACTGGGGATTGTGAGACAGTGG - Intronic
1072556613 10:96520722-96520744 AAGTGGGGATGGGGTAAAAGTGG - Exonic
1072660975 10:97363335-97363357 CAGGGGTAATGGTGGCAAAGAGG + Intronic
1072766018 10:98095839-98095861 CAGGGCGCATGGTGGCAAAGTGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1074016857 10:109542904-109542926 CATTGGGGCTGGTTGGACAGTGG - Intergenic
1074120986 10:110494477-110494499 CAGTGGGGATGGGGGATAATGGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075297861 10:121293802-121293824 CAGTGGGGATGCTGGGGACCAGG + Intergenic
1075712942 10:124540440-124540462 CAGTGGGGTTGGTGGGCGAGCGG - Intronic
1075995681 10:126874294-126874316 AAGTGGGGAGGGAGGCAAAGAGG - Intergenic
1076064974 10:127441689-127441711 CAGTGGGGGTGGTGGGGGGGTGG - Intronic
1076338063 10:129723268-129723290 CAGGGGGAATGGTTGGGAAGTGG - Intronic
1076538141 10:131196052-131196074 CAGTGGGGCTGCTGGCAATGGGG - Intronic
1076616224 10:131756645-131756667 CCCTGGGCATGGTGGGGAAGTGG - Intergenic
1077223388 11:1427126-1427148 CAGTGGGGCTGTGGGGAGAGAGG - Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077819870 11:5726898-5726920 CAGTGAGGATTGTGGCATAGCGG - Intronic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1079001247 11:16758748-16758770 CAGAGGGGGTGGTGGGAACCAGG - Intergenic
1079037612 11:17034520-17034542 CACTGGGGATTGTCGGACAGAGG - Intergenic
1079089617 11:17471412-17471434 CAGTGGGTCTGGTGGGACTGAGG + Intronic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079174776 11:18128791-18128813 CACTGGGGATTGTCGGACAGTGG - Intronic
1079177659 11:18157903-18157925 CACTGGGGATTGTCGGACAGGGG + Intronic
1079309942 11:19356273-19356295 CAGGGGGGAGGATGGCAAAGGGG + Intronic
1079382123 11:19947487-19947509 CAGTGACGATGGTGGAAAAAGGG - Intronic
1079516132 11:21272030-21272052 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1079865160 11:25724750-25724772 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
1080081432 11:28222566-28222588 CACTGGGGATTGTAGGACAGTGG - Intronic
1080997273 11:37619250-37619272 CAGTGGGGATTGTGGGGTGGGGG - Intergenic
1081405000 11:42688133-42688155 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1081454458 11:43207245-43207267 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1082038716 11:47667172-47667194 CAGAGGGTATGGTGGGAGTGTGG + Intronic
1082103264 11:48192109-48192131 AAGTGGGGGTGGGGGGACAGGGG - Intergenic
1082636321 11:55598469-55598491 CACTGGGGAATGTTGGAAAGTGG - Intergenic
1082653847 11:55828016-55828038 CAGTGGAGATGTTGACAAAGTGG + Exonic
1082684295 11:56219579-56219601 CACGGGGGAGTGTGGGAAAGTGG + Intergenic
1082795077 11:57372887-57372909 CAGTGGAAATGGTGGGAGTGGGG - Intergenic
1082820700 11:57542885-57542907 GAGGGAGGCTGGTGGGAAAGAGG + Exonic
1083003724 11:59321464-59321486 CATTGGGACTGGTTGGAAAGTGG - Intergenic
1083009958 11:59387661-59387683 CACTGGGGAATGTAGGAAAGTGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083186205 11:61019386-61019408 GAGCTGGGAGGGTGGGAAAGGGG - Exonic
1083541331 11:63513402-63513424 CAGTTGGGAAGGTGGTAAAGGGG + Intronic
1083590335 11:63889915-63889937 CAGGGAGGATGGTGGTAGAGGGG + Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083735386 11:64677340-64677362 GGGAGGGGATGGTGGGGAAGAGG - Intronic
1083766660 11:64844681-64844703 CAGCGGGGAGGGCGGGAGAGGGG - Intergenic
1083894130 11:65611696-65611718 CAGTGGGGAGGGTGGGGAGCAGG + Intronic
1084039310 11:66532165-66532187 CAGTGGGGGTGGTGAGGAAGCGG - Exonic
1084166309 11:67376278-67376300 CAGTGTGGAAGGTGGGGGAGGGG - Intronic
1084597250 11:70124312-70124334 CAGTGGGGTTGGTGACAATGTGG - Intronic
1085222556 11:74887550-74887572 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1085247930 11:75119405-75119427 CACTGGGGATTGTTGGACAGTGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085402501 11:76243202-76243224 AAGTGGGCCTGGTGGGAGAGAGG + Intergenic
1085505385 11:77055959-77055981 CCCTGGGGATGGTGGGGAGGTGG + Intergenic
1086012250 11:82120067-82120089 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1086142901 11:83518541-83518563 CACTGGGGATTGTCGGATAGCGG - Intronic
1086417892 11:86607368-86607390 CAATGAGTATGGTGGGAAAAGGG - Intronic
1086509965 11:87545481-87545503 CAGTGAGGATGTGGGGAAAAAGG - Intergenic
1086869118 11:92015543-92015565 CATTGGGACTGGTTGGAAAGTGG - Intergenic
1087008270 11:93489794-93489816 CATTGGGGATGGAGGGGGAGAGG - Intronic
1087103152 11:94384468-94384490 CACTGGGGATTGTCGGACAGTGG + Intronic
1088027889 11:105208590-105208612 CAGTAGCCATGGTGAGAAAGTGG - Intergenic
1088491107 11:110388776-110388798 CACTGGGGATTGTTGGACAGTGG - Intergenic
1088527642 11:110773976-110773998 GAGTGGGGATGGTGGATAAATGG + Intergenic
1088921046 11:114259941-114259963 CAGTCAGGGTGGTGGGTAAGGGG - Intronic
1089011185 11:115133070-115133092 CAGTGCTGACGTTGGGAAAGAGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089128360 11:116193150-116193172 GGGTGGGGAAGGTGGAAAAGTGG + Intergenic
1089162641 11:116451297-116451319 AAGTGGGGAAGGTGAGAATGAGG + Intergenic
1089634358 11:119802949-119802971 CAGTGTGACTGGTGGAAAAGTGG + Intergenic
1090498883 11:127242331-127242353 GATGGGGGGTGGTGGGAAAGTGG - Intergenic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091259268 11:134221519-134221541 AAGGGGGGATGGAGGGATAGGGG - Intronic
1091279839 11:134375508-134375530 CAGTGTAGAGGGTGGGGAAGGGG + Exonic
1091296118 11:134475135-134475157 CAGTGGTGAGGGTGGGAGTGAGG - Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091388760 12:112301-112323 GAAGGGGGATGGTGGGGAAGTGG + Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091610590 12:2004393-2004415 CAGGCGGCCTGGTGGGAAAGGGG - Exonic
1091838967 12:3605521-3605543 GAGGAGGGATGGTGGGGAAGAGG + Intergenic
1091849927 12:3687351-3687373 CACTGGGGCTGGTTGGACAGTGG - Intronic
1091985574 12:4908535-4908557 GCGTGTGGAAGGTGGGAAAGGGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092718418 12:11416295-11416317 CACTGGGGATTGTCGGACAGTGG + Intronic
1092725379 12:11480445-11480467 GAGTGGGGGTGGTGGAGAAGGGG - Intronic
1092742216 12:11640848-11640870 CACTGGGGATAGTGGGATACTGG - Intergenic
1094162310 12:27404729-27404751 CACTGGGGATTGTTGGACAGTGG + Intronic
1094580366 12:31728864-31728886 CGGCGGGGGGGGTGGGAAAGGGG + Intronic
1094776591 12:33736541-33736563 CATTGGGGAAGGGGGGAATGGGG - Intergenic
1095310754 12:40693562-40693584 AAATTGGGATGATGGGAAAGAGG + Intronic
1095359026 12:41313298-41313320 AACTGGGGATGGTGAAAAAGTGG - Intronic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096806910 12:54146567-54146589 CAGTGGGGGTGGGGGGAGAGTGG - Intergenic
1096895609 12:54818586-54818608 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1097154947 12:57006026-57006048 CAGAGGAGAGGGTGGGAGAGGGG + Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097535949 12:60871013-60871035 AGGTTGGGATGGTGGGATAGAGG - Intergenic
1097774285 12:63628194-63628216 CACTGGGGATTGTCAGAAAGTGG + Intronic
1098215433 12:68211552-68211574 CAGTAGTGATGCTGGGAAGGAGG - Intronic
1099580538 12:84441214-84441236 CAGTGGGAAAGGTGGTATAGAGG - Intergenic
1099764829 12:86970507-86970529 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100652429 12:96604984-96605006 CATTGGGGCTGGTTGGACAGTGG - Intronic
1100907841 12:99321692-99321714 CAGTGGGGTTTGTCGGACAGTGG - Intronic
1101022873 12:100571828-100571850 CAGAAGGGATGGTGAGGAAGAGG - Intergenic
1101401816 12:104394571-104394593 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1101527662 12:105546313-105546335 CAAAGGTGAGGGTGGGAAAGGGG + Intergenic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1101954893 12:109204630-109204652 TAGTGGGGCTGGTGGGAGTGGGG - Intronic
1102067867 12:109993449-109993471 CAGTGAGTATGGTGGTTAAGAGG + Intronic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1102782706 12:115579166-115579188 CAGTGGGGGTGATGGCAGAGAGG + Intergenic
1103255486 12:119538423-119538445 CATTGGGACTGGTTGGAAAGTGG - Intronic
1103365223 12:120377413-120377435 CAGTGCTGACGGTGGGAAAGGGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105419961 13:20243385-20243407 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1105423815 13:20276508-20276530 AAGTGGAGAGGGTGGGAATGGGG + Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106538028 13:30665113-30665135 GAGAAGGGATGGTGAGAAAGTGG + Intergenic
1106588080 13:31074389-31074411 CAGTGGGGAGGGAGGATAAGTGG - Intergenic
1107954789 13:45501139-45501161 CAGTGTGGAAAGTGGGGAAGAGG - Intronic
1108153675 13:47563719-47563741 CACTGGGACTGGTTGGAAAGTGG + Intergenic
1108319287 13:49272154-49272176 CAGTGTTGATGGTAGAAAAGGGG + Intronic
1108474012 13:50795484-50795506 CAGTGGAGATGATGTGAAAAAGG + Intronic
1108791835 13:53978629-53978651 TAGTGGGGAAGGTTGGGAAGGGG + Intergenic
1108988713 13:56628811-56628833 CACTGGGACTGGTTGGAAAGTGG + Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1109757663 13:66782117-66782139 GAGTGGGGCTGGGAGGAAAGAGG - Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110287866 13:73771016-73771038 AAGTGGGGATGGTGGGAGATAGG - Intronic
1110502303 13:76242981-76243003 CACTGGGGAGTGTAGGAAAGTGG + Intergenic
1110863117 13:80365982-80366004 GAGGGGGGAAGGTGGGGAAGGGG + Intergenic
1110892612 13:80708493-80708515 CACTGGGGATTGTTGGACAGTGG - Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112075295 13:95906916-95906938 CAATGGGACTGGTTGGAAAGTGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787921 13:113012443-113012465 CAGTGCGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1114592506 14:23879967-23879989 CAGTGAGGATGTGGGGAAAGGGG + Intergenic
1114630570 14:24157040-24157062 CAGTAGGGATGAAGGAAAAGGGG + Intronic
1114635609 14:24185150-24185172 CAGTGGGGAGCTTGGGGAAGGGG - Intronic
1114737873 14:25061630-25061652 GAGTGGGAAGGGTGGGATAGGGG + Intergenic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1114835840 14:26202315-26202337 TATTTGGCATGGTGGGAAAGTGG - Intergenic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115123181 14:29961370-29961392 CACTGGTGATTGTTGGAAAGTGG - Intronic
1115268111 14:31522594-31522616 GGGTGGGGATGGTGGGAGACAGG - Intronic
1115294712 14:31812642-31812664 CACTGGGACTGGTGTGAAAGTGG - Intronic
1115382853 14:32759324-32759346 CAGAGGGCATGATGGAAAAGAGG - Intronic
1115743433 14:36411840-36411862 CACTGGGGATTGTCGGACAGTGG + Intergenic
1115792795 14:36898547-36898569 CACTGGGGAGTGTCGGAAAGTGG - Intronic
1115814849 14:37152975-37152997 AAGTGGGGAAGGAGGAAAAGAGG + Intronic
1115835440 14:37397366-37397388 CAGTGGAGGTGGTGGGAGTGGGG + Intronic
1116011749 14:39359565-39359587 CACTGGGGATTGTCGGACAGTGG - Intronic
1116031335 14:39576544-39576566 CAGTGTGGAAGGTGGGCTAGGGG + Intergenic
1116098693 14:40406850-40406872 TAGTGGGGAAGATAGGAAAGGGG + Intergenic
1116101657 14:40445867-40445889 CAGTGAGATTTGTGGGAAAGAGG - Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116883087 14:50191689-50191711 CAGTGGGGATTATGGTAAACCGG + Intronic
1117015310 14:51511722-51511744 CAGTTGGGATGGTGGACTAGGGG + Intronic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117852632 14:59991444-59991466 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1117891604 14:60427491-60427513 CACTGGGGATTGTTGGACAGTGG - Intronic
1118494609 14:66295905-66295927 CATTGGGACTGGTTGGAAAGTGG + Intergenic
1119298524 14:73552610-73552632 CACAGGGGATTGTGGGAATGGGG - Intronic
1119302821 14:73584797-73584819 CACAGGGGATTGTGGGAATGGGG - Intergenic
1119672157 14:76528049-76528071 CAAAGGGCATGGTGAGAAAGTGG - Intergenic
1119699577 14:76744392-76744414 CACTGGGGATTGTTGGAAAGTGG + Intergenic
1121298823 14:92852937-92852959 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1121327614 14:93030656-93030678 CAGAGGGCATGATAGGAAAGGGG + Intronic
1122128460 14:99591662-99591684 CGGTGGGGAGGGTGGGGAGGTGG + Intronic
1122373779 14:101244423-101244445 CGGTGAGGATGGTGAGAAACTGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122885161 14:104707583-104707605 CAGGGGGGGTGGTGGGGGAGGGG - Exonic
1122967142 14:105136673-105136695 CACTGTGGATGGTGGGATGGGGG - Intergenic
1123044190 14:105503378-105503400 CAGAGGGGATGGCTGGCAAGTGG + Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124166532 15:27331099-27331121 CAGTGGGGATGTGGGGCAACAGG + Intronic
1124172846 15:27392111-27392133 CAGTGGGGATAATGGGGATGTGG - Intronic
1124372620 15:29112056-29112078 CACTGGGCATGGTGGGGATGGGG - Intronic
1124421389 15:29526374-29526396 CAGTGGGGGTTGGAGGAAAGAGG - Intronic
1124570047 15:30854619-30854641 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
1124624882 15:31302158-31302180 CAGTGGGAACTGTGGGACAGAGG + Intergenic
1125156850 15:36597375-36597397 GAGTTGGGATGGTGGTAGAGAGG - Intronic
1125356128 15:38818865-38818887 GAGTGGGGGTGGCAGGAAAGGGG - Intergenic
1125365192 15:38905972-38905994 AAGTGGGGATTAAGGGAAAGAGG - Intergenic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125779552 15:42252254-42252276 CACTGGGAATGGTTGGACAGTGG - Intronic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1126071170 15:44865896-44865918 CATTGGGAATGGTTGGACAGTGG + Intergenic
1126358005 15:47816601-47816623 CAGAGGGGATTGTGGGAATCAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126721956 15:51591060-51591082 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1126736897 15:51739120-51739142 CAGTTGGGCAGGTGGGAAAAAGG - Intronic
1127180722 15:56414385-56414407 AAGTGGGGAAGGTGGAAAAAGGG - Intronic
1127189655 15:56515928-56515950 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1127729336 15:61784098-61784120 CAGTGGGGAAGGTTGGGAGGAGG + Intergenic
1127795872 15:62437975-62437997 CAGAGGCGAGAGTGGGAAAGGGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128339892 15:66814006-66814028 CATTGGGACTGGTCGGAAAGTGG - Intergenic
1128677578 15:69623031-69623053 CACTGGGGATTGTCGGACAGTGG - Intergenic
1128752974 15:70162197-70162219 TGGTGGTGATGGTGGGAGAGAGG + Intergenic
1128780738 15:70357176-70357198 CAGAGGAGGGGGTGGGAAAGTGG + Intergenic
1129240614 15:74249912-74249934 CATAGGGGAAGGTGGGAGAGTGG - Intronic
1130520938 15:84660148-84660170 CAGTGGGACTTCTGGGAAAGTGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1130703722 15:86211847-86211869 CATTGGGACTGGTGGGACAGTGG - Intronic
1130798459 15:87235762-87235784 CACTGGGGATTGTCAGAAAGTGG - Intergenic
1130800306 15:87255749-87255771 CACTGGGGATTGTTGGAAAGTGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131074054 15:89483831-89483853 CAGGGAGGATGGAGGCAAAGGGG + Intronic
1131273596 15:90961580-90961602 CAGTGGAGACGATGGCAAAGGGG + Intronic
1131388263 15:92025861-92025883 CAGTGGAGATGCTGGAAGAGTGG + Intronic
1131973738 15:97919682-97919704 CAGTAGGGGAGGTGGTAAAGAGG + Intergenic
1132216651 15:100067880-100067902 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132563413 16:609326-609348 CACTGGGGATGGTGGGGGACAGG + Intronic
1132701130 16:1222618-1222640 CCGTGGGGATGCTGGGATGGAGG - Intronic
1132715219 16:1286675-1286697 CAGTGTGGTTGGAAGGAAAGCGG + Intergenic
1132975064 16:2706911-2706933 CAGTGGGCATGGAGGAACAGAGG + Intronic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1134276810 16:12783627-12783649 CAGTGTGATGGGTGGGAAAGTGG - Intronic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135269909 16:21060339-21060361 CATAGGGCATGGTGGAAAAGTGG - Exonic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136043638 16:27599394-27599416 GGGTGGGGAAGGTGGGAATGAGG + Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136271736 16:29152609-29152631 CAGAGGGGCTGTTGGGGAAGAGG + Intergenic
1136394128 16:29983634-29983656 CGGTTCGGATGGTGGCAAAGTGG - Exonic
1138534753 16:57653945-57653967 CGGTGGTGATGGTGGGGAGGGGG - Intronic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1139361493 16:66402575-66402597 CAGTGGGGATGGGGGCATGGGGG + Intronic
1139375908 16:66496096-66496118 CACTGGGGAGTGTTGGAAAGTGG + Intronic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1140539294 16:75740815-75740837 CACTGGGGATTGTTGGACAGTGG - Intronic
1140974479 16:80045722-80045744 CAGTGAAGAGGGTGGGGAAGAGG + Intergenic
1141028876 16:80570936-80570958 GAGTGTGGATGGAGGGAGAGTGG - Intergenic
1141059559 16:80853189-80853211 AAGTGGGGATGGTGGCAACGTGG - Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1142075403 16:88114769-88114791 CAGAGGGGCTGTTGGGGAAGAGG + Intronic
1142112696 16:88340745-88340767 CAGAGGGGAGGGTGGGTCAGAGG + Intergenic
1142112704 16:88340762-88340784 CAGAGGGGAGGGTGGGGCAGAGG + Intergenic
1142312582 16:89322671-89322693 CACTGGGGAGGGTGGGGAAGGGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1142937312 17:3345937-3345959 AAGTGGGGATGGGGGAGAAGGGG + Intergenic
1143046546 17:4085213-4085235 CAGTGGGGAAAGGAGGAAAGGGG + Intronic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143422797 17:6808480-6808502 CACTGGGGAGTGTCGGAAAGTGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143725803 17:8844814-8844836 GAATGGGGAGGGAGGGAAAGGGG - Intronic
1144150395 17:12437648-12437670 CAGTGGGGGTGGGGGAAATGGGG - Intergenic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144255106 17:13459945-13459967 GAGTGAGCATGGTGGGACAGAGG - Intergenic
1144424945 17:15132912-15132934 CAGTGGGGATTATAGAAAAGAGG + Intergenic
1144493130 17:15731592-15731614 CAGTGGGGTCAGTGGGAACGTGG + Intergenic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144907125 17:18645060-18645082 CAGTGGGGTCAGTGGGAACGTGG - Intronic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145245406 17:21265907-21265929 CAGTGTGGAGTGTGGCAAAGTGG + Intergenic
1145257982 17:21337999-21338021 CAAGGGGGATGGTGGGCAAGAGG - Intergenic
1145318655 17:21750007-21750029 CAAGGGGGATGGTGGGCAGGAGG + Intergenic
1145870014 17:28266282-28266304 TAGCCGGGATGGTGGGAACGGGG - Intergenic
1146100698 17:29978950-29978972 CAGGGGGGATGGGGGGAGTGGGG + Intronic
1146179322 17:30687227-30687249 CAGGCGTGATGGTGGGAATGTGG - Intergenic
1146371770 17:32268938-32268960 CAGTGAGGATGGACGGGAAGAGG + Intronic
1146683351 17:34824275-34824297 CTGTGTGGAAGGTGGGAATGTGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146732381 17:35204822-35204844 CACTGGGGATTGTCGGACAGTGG - Intergenic
1147249322 17:39143784-39143806 CAGTGGGCATCTTGGGGAAGGGG - Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147572865 17:41582229-41582251 GAGTGGGGGTGGGGAGAAAGTGG - Intergenic
1147616887 17:41835069-41835091 CAGTGAGGAGTGTCGGAAAGAGG - Exonic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148231943 17:45941631-45941653 AAGGGGGGAAGGAGGGAAAGAGG - Intronic
1148488980 17:48011297-48011319 TAGTGGGGAGGGTAGAAAAGGGG + Intergenic
1148677686 17:49454662-49454684 TGGTGGGGATGGTGGGGTAGAGG + Intronic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1149222795 17:54435656-54435678 CACTGGGAATGGTTGGACAGTGG + Intergenic
1149610718 17:57955953-57955975 CACAGGAGATGGTGGGAAGGGGG + Intergenic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150580405 17:66468711-66468733 GAGGGTGGAGGGTGGGAAAGTGG + Intronic
1150604685 17:66680792-66680814 GGGTGGGGGAGGTGGGAAAGGGG + Intronic
1151162644 17:72178451-72178473 CAGTGAAGGTGGTGGGATAGGGG - Intergenic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1151251459 17:72838928-72838950 CAGTGGGGATGGCAGGGAATGGG - Intronic
1151629489 17:75300869-75300891 CAGCGGGGATGGCGAGAAACTGG - Intergenic
1151698642 17:75731015-75731037 AAGTGGGCAGGGTGGGCAAGAGG + Intronic
1151976269 17:77485064-77485086 TAATGGTGATGGTGGTAAAGGGG + Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153114539 18:1639360-1639382 CAGTGTGGTTGGTTAGAAAGTGG + Intergenic
1153992856 18:10415336-10415358 CAGTGTGGATGATCGGGAAGGGG - Intergenic
1154320722 18:13349087-13349109 CACTGGGGATTGTCGGACAGTGG - Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1154383523 18:13873066-13873088 CAGTGTGGAGGGCTGGAAAGGGG + Intergenic
1155426881 18:25716260-25716282 CACTGGGGATTGTCGGACAGTGG + Intergenic
1156233150 18:35174494-35174516 CAGTGGGGATGGGGGTGGAGTGG - Intergenic
1156279986 18:35627702-35627724 CACTGGGGATTGTCGGACAGTGG + Intronic
1156337322 18:36183353-36183375 CAGTGGGGGAGGTGGGAGTGGGG - Intergenic
1157194521 18:45610076-45610098 GAGAGGGGATGGTGGGAGAGGGG - Intronic
1157205461 18:45694582-45694604 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1157279327 18:46335312-46335334 GAGAGGGGATGTGGGGAAAGGGG - Intronic
1157325086 18:46663206-46663228 GAGTGGGGTTGGTGGAAATGGGG - Intergenic
1157470098 18:47982455-47982477 GAGGGGGGATGGGGGGATAGTGG + Intergenic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157540912 18:48505822-48505844 CAGTGGAGGTGGTGGGAGGGTGG - Intergenic
1159002948 18:62989276-62989298 GAGTGCTGATGGTGGGAAGGTGG - Intergenic
1159502845 18:69296197-69296219 TAGTGGGGATGGGGGGGACGTGG - Intergenic
1160548426 18:79677938-79677960 AAATGGGGATTGTGGGAAAATGG - Intergenic
1160566750 18:79790697-79790719 CAGTGAGGGTGGCGCGAAAGAGG - Intergenic
1160888875 19:1366453-1366475 GCGTGGGGATGGAGGGACAGAGG + Intronic
1161010738 19:1958441-1958463 CAGGGGAGATGGGGGGACAGGGG - Intronic
1161118344 19:2511844-2511866 CCCTGGGGAGGGTGGGAGAGGGG + Exonic
1161513456 19:4684019-4684041 CAGTGGCGGTGGTGGGGATGTGG - Intronic
1161743417 19:6039899-6039921 CAGCAGGGATGGTGAGTAAGAGG - Intronic
1161879424 19:6937451-6937473 CGGTGGGGAAGGGGGGAGAGGGG - Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162313305 19:9920546-9920568 CAGTGATGATGATGGGGAAGAGG - Intronic
1162427375 19:10604505-10604527 CCCTGGGGATGGTGTGGAAGAGG + Intronic
1162452690 19:10764386-10764408 CACTGGGGATGGCTGGAATGAGG - Intronic
1162534486 19:11254698-11254720 CAGGGAGGATGGGGGTAAAGGGG + Intronic
1163549409 19:17957224-17957246 GGGAGGGGATGGTGGGGAAGGGG + Intronic
1164096244 19:22012320-22012342 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164115749 19:22217146-22217168 CAGTGGGAAGGGTAGGAGAGGGG - Intergenic
1164199465 19:23004641-23004663 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164265551 19:23613539-23613561 CACTGGGGATTGTCGGACAGTGG + Intronic
1164377520 19:27701453-27701475 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
1164397503 19:27878831-27878853 AAGTAGGGAAGGTGAGAAAGAGG + Intergenic
1164723449 19:30449595-30449617 AAGTGTTGATGGTGGGAAGGGGG + Intronic
1164986384 19:32651784-32651806 CAGTGGGGATGCAGTGAATGGGG - Intronic
1165158174 19:33800560-33800582 CACTGGGGAAGAAGGGAAAGAGG - Intronic
1165261542 19:34623454-34623476 CAGAGGAGATGGGAGGAAAGAGG - Intronic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165456184 19:35912150-35912172 CAGTGTGGAAGCTGGGAGAGTGG - Intergenic
1165735417 19:38172653-38172675 CAGGTGGGATGGGGGGAGAGTGG + Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1166328656 19:42066292-42066314 AACTGGGGATGTTAGGAAAGTGG - Intronic
1166341257 19:42138619-42138641 CAATGGGGAGGCTGGGACAGTGG + Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1167322470 19:48805636-48805658 CAGGGGGGATGGCGGGAGAGGGG - Intronic
1167400265 19:49262094-49262116 GAGTGGGGATGATGGGGGAGTGG + Intergenic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168433028 19:56296182-56296204 CAGTGGGGACAGTGTGCAAGAGG + Intronic
1202697138 1_KI270712v1_random:133379-133401 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
925999053 2:9315497-9315519 AAGTGAGGAGGGTGGGAGAGAGG + Intronic
926328585 2:11806193-11806215 CAGTGGTGATGGTAGGGAATGGG + Intronic
926893308 2:17657733-17657755 GAGTGGGAATGCTGGGACAGAGG - Intergenic
926924837 2:17976910-17976932 CAGTGGGGACTGTGGGGAAGAGG - Intronic
927027892 2:19089372-19089394 CACTGGGACTGGTGGGACAGTGG + Intergenic
927175166 2:20400645-20400667 CACAGGGAAAGGTGGGAAAGAGG - Intergenic
927178920 2:20430073-20430095 GAGTGGGGAGGGTGGTAAACGGG - Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927871027 2:26623813-26623835 CACTGGGGATGGCTGGAAACAGG - Intronic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
928487606 2:31748638-31748660 CACTGGGGATTGTTGGACAGTGG + Intergenic
928851460 2:35752648-35752670 TGGCGGGGATAGTGGGAAAGTGG - Intergenic
929167400 2:38896841-38896863 CAGTGGTTATGCTTGGAAAGAGG - Intronic
929233231 2:39581027-39581049 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
929496872 2:42452504-42452526 TAGCGGGGGTGGTGGGGAAGTGG - Intronic
929768285 2:44869142-44869164 GAGTGGAGGTGGTAGGAAAGAGG - Intergenic
929788188 2:45006761-45006783 TATTGGGGAAGGGGGGAAAGAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930323244 2:49882001-49882023 CACTGGGAATGGTTGGACAGTGG + Intergenic
930624433 2:53680877-53680899 TAGTGGGGATGGGGGGTGAGAGG - Intronic
930908967 2:56606832-56606854 CACTGGGGCTGGTTGGAAAGTGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931400146 2:61924376-61924398 GAGGGGGGATGGTTGGAGAGGGG + Intronic
931888970 2:66648608-66648630 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
932212340 2:69943140-69943162 CAGTGGAGAGGGTGGGACTGTGG - Intergenic
933532228 2:83525217-83525239 AAGTGGGGAGGGTGGGAATAGGG + Intergenic
933542872 2:83670904-83670926 CATTGAGGATGGCGGGACAGTGG - Intergenic
933593830 2:84262483-84262505 CACTGGGGATTGTCGGACAGTGG + Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933698105 2:85235422-85235444 CTCTGGGGATGCTGGGAATGTGG + Intronic
933747965 2:85584540-85584562 GAGTGGCGAGGGTGGGAGAGAGG + Intronic
933819234 2:86094814-86094836 CAGTGGCAGTGGTGGGAGAGTGG - Intronic
933835782 2:86244540-86244562 CAGAGGTCATGGTGTGAAAGCGG + Intronic
933991851 2:87639661-87639683 CAGTGGGGGTCTTGGGAATGAGG - Intergenic
934038418 2:88107956-88107978 CACTGGGGATTGTCGGACAGTGG - Intronic
934278304 2:91590395-91590417 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
934550447 2:95258081-95258103 CACTGGGGATTGTTGGACAGTGG - Intronic
935118319 2:100157673-100157695 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
935179723 2:100678583-100678605 CAGAGGGGATGGTTGGAGAAGGG + Intergenic
935332727 2:101988803-101988825 GAGGGGGGTTGGAGGGAAAGTGG + Intergenic
936301993 2:111311157-111311179 CAGTGGGGGTCTTGGGAATGAGG + Intergenic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
936580769 2:113698606-113698628 TATTGGGGGTGGGGGGAAAGGGG + Intergenic
936584399 2:113741271-113741293 GGCTGGGGGTGGTGGGAAAGAGG + Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936919805 2:117676278-117676300 CAGTGGGGAGGGTGAGAACAGGG + Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937227783 2:120379525-120379547 GACTGGGGAGGGTGGTAAAGTGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
937810644 2:126195726-126195748 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
937887174 2:126907886-126907908 AAGTGGGGAGGCTGGGCAAGAGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938287705 2:130130804-130130826 CAGTGGGGAAAGTGGGTAAGTGG + Intergenic
938427886 2:131208054-131208076 CAGTGGGGAAAGTGGGTAAGTGG - Intronic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938639568 2:133265705-133265727 CAGTGCGGAGGGTGGGGGAGGGG + Intronic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
938837092 2:135115940-135115962 CTGTGGGGTTGGGGGGAATGGGG + Intronic
938862155 2:135380979-135381001 CACTGGGGATTGTGGGACAGTGG + Intronic
938864371 2:135403081-135403103 CACTGGGGAGTGTCGGAAAGTGG + Intronic
939090418 2:137773912-137773934 AAGAGGAGAGGGTGGGAAAGGGG - Intergenic
939157728 2:138544747-138544769 CACTGGGGAGTGTCGGAAAGTGG - Intronic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
939472356 2:142639661-142639683 AAGGTGGGATGGTGGGAGAGGGG - Intergenic
939660424 2:144882156-144882178 AAGTGTGGAGGGTGGGAAGGTGG - Intergenic
940029145 2:149241939-149241961 CAGTGGGGATGGTTGGGGATGGG + Intergenic
940067282 2:149643869-149643891 CACTGGGGATTGTCGGACAGTGG - Intergenic
940659011 2:156523546-156523568 TAGTGGGGAGTGGGGGAAAGGGG - Intronic
941264263 2:163340290-163340312 CAGTGGGAAAAGTGGAAAAGTGG + Intergenic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941776487 2:169399294-169399316 CACTGGGGATTGTCGGACAGTGG + Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
943654783 2:190496905-190496927 CAGGGGAAAGGGTGGGAAAGGGG + Intronic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
944091896 2:195921069-195921091 CAGTGTGGATGTAGTGAAAGGGG + Intronic
944778981 2:202998224-202998246 GAGTGGGGAGGGTGGGATAGGGG - Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945194270 2:207223787-207223809 CAGTAGGGATGGGGGCTAAGTGG - Intergenic
945422531 2:209656919-209656941 AAGGCGGGAGGGTGGGAAAGAGG - Intronic
945843546 2:214916225-214916247 AAGTAGGGAGGATGGGAAAGGGG - Intergenic
946157495 2:217816668-217816690 CAGGGAAGATGGTGGGAAACAGG + Intronic
946493426 2:220171906-220171928 TGGTGGGGATGGTGGTAAACTGG + Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946854004 2:223934923-223934945 GAGTGGGAATGGTGGTATAGTGG + Intronic
947108807 2:226696671-226696693 CAGGGGTGATGGTGGTAGAGGGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
948832195 2:240603581-240603603 CAGTGGGAAAGTTGGGGAAGGGG - Intronic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
1169060529 20:2657549-2657571 CAGTGGGGATGGGGGCAGGGAGG + Intronic
1169219743 20:3815103-3815125 CGGGTGGGAAGGTGGGAAAGGGG + Intergenic
1169307144 20:4501833-4501855 CACTGGGACTGGTTGGAAAGTGG - Intergenic
1169450959 20:5710572-5710594 CACAGCGTATGGTGGGAAAGTGG - Intergenic
1169614818 20:7429059-7429081 GAGAAGGGATGGTAGGAAAGTGG - Intergenic
1169781294 20:9313768-9313790 CAGTGGTGGTGGTGGTATAGCGG - Intronic
1170036563 20:11995973-11995995 CAGTGGGGAAAGTGGAAAATTGG + Intergenic
1171070345 20:22062291-22062313 AAGGGAGTATGGTGGGAAAGTGG - Intergenic
1171081786 20:22194241-22194263 CATTGGGACTGGTTGGAAAGTGG + Intergenic
1172077567 20:32310941-32310963 CAGTGGTGGGGGTGGGGAAGAGG + Exonic
1172178697 20:32987636-32987658 CAGGGGGGATGGCGGGAGATGGG - Intronic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172641999 20:36446137-36446159 CAGAATGGATGTTGGGAAAGGGG - Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1173008682 20:39160804-39160826 CTCTGGTGATGGGGGGAAAGTGG - Intergenic
1173046422 20:39517123-39517145 CAGTGCTGGTGGTGGTAAAGAGG - Intergenic
1173201538 20:40958797-40958819 CACTGTGGGGGGTGGGAAAGCGG - Intergenic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1174113378 20:48211297-48211319 GAGTGGGGATTGTGGCAAAGTGG - Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174376397 20:50129248-50129270 TAGTGGGGACGGTGGTAAACTGG + Intronic
1174392915 20:50228912-50228934 CTGTGGGGCTGGTTGGATAGAGG - Intergenic
1175050468 20:56151041-56151063 TAGTGGGGAGTGTGGCAAAGTGG - Intergenic
1175147822 20:56910180-56910202 AAGTGGGGAGTGTGGGGAAGGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175403120 20:58711701-58711723 CACTTGGGATGGTGGGGCAGGGG - Intronic
1175539115 20:59737160-59737182 CAGGGGCTATGATGGGAAAGGGG - Intronic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176111395 20:63412441-63412463 CAGAGAGGACGCTGGGAAAGAGG + Intronic
1176200452 20:63858046-63858068 CGGTGGGGTTGGTGGGGGAGTGG - Intergenic
1176902860 21:14464524-14464546 CAGTGGGGAGGAAGGGGAAGGGG + Intergenic
1176954274 21:15082627-15082649 CAGTGGGCATGGTCATAAAGAGG - Intergenic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1177447023 21:21210871-21210893 GAGTTGGGAGGGTGGGAAATGGG + Intronic
1178032043 21:28539029-28539051 AAGTGGGGAGGGTGGAAAGGGGG - Intergenic
1178903508 21:36616648-36616670 CACTGGGGATTGTCGGACAGTGG + Intergenic
1178961220 21:37067545-37067567 GGGTTGGGATGGTGGGATAGAGG - Intronic
1179296992 21:40071984-40072006 CAGAGGTGAGGGTGGTAAAGGGG - Intronic
1179318356 21:40267024-40267046 AAGTGGGGAGGGTGGGAGGGAGG + Intronic
1179884101 21:44306152-44306174 AAGTGGGGCAGGTGGAAAAGAGG - Intronic
1180156926 21:45982462-45982484 CGGTGGGGACGGTGGGGAGGGGG - Intronic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
1181109012 22:20590614-20590636 CAGTGGTGATGGTGGGCACAGGG - Intergenic
1181618326 22:24070513-24070535 AAGTGGGGATGCTGGGAATGAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183100411 22:35580391-35580413 CAGTGGAGCTGGGAGGAAAGAGG - Intergenic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1183354363 22:37350533-37350555 CGGTGGGGAGGCAGGGAAAGAGG - Intergenic
1183495408 22:38140551-38140573 CAGTGTGGATGGGAGGGAAGGGG + Intronic
1183944732 22:41318787-41318809 CAGTGGGGAGGGTGGTGAATAGG - Intronic
1183971319 22:41479651-41479673 CAGTGAGGCTGGTGGGGGAGAGG + Intronic
1184096187 22:42317726-42317748 CAGTGGGGAGGGTGGAAGAAGGG + Intronic
1184480538 22:44744344-44744366 CAGTGGGCCTGATGGGAAACCGG + Intronic
1184908137 22:47505971-47505993 AAGAGGGGAAGGTGGGAAAGGGG - Intergenic
1185126958 22:49016726-49016748 CAGTGGGGGTGTCCGGAAAGAGG - Intergenic
1185242103 22:49752147-49752169 CAGGGGGCAGGGTTGGAAAGAGG + Intergenic
949209158 3:1477595-1477617 CACTGGGGCTTGTGGGACAGTGG + Intergenic
949288096 3:2430082-2430104 CACTGGGGATTGTCGGACAGCGG - Intronic
949396799 3:3623046-3623068 CAGTGAGGAAGTGGGGAAAGTGG - Intergenic
949745821 3:7291071-7291093 CAGTGAGGATGCTGGGAAGAGGG - Intronic
949919188 3:8987997-8988019 GGGTGGGGATGGTGGTAGAGGGG - Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950326443 3:12114778-12114800 CTGTGGAGAAGGTGGGGAAGAGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950615426 3:14154146-14154168 CAGTGAGGATGTGGAGAAAGTGG + Intronic
950631603 3:14285680-14285702 CAGTGGGGGTGGGGGGATTGAGG - Intergenic
950664646 3:14487954-14487976 CTGTGAGGATGGTGGGAGTGTGG - Exonic
950758583 3:15199758-15199780 AAGTGGGTAGCGTGGGAAAGAGG + Intergenic
950889105 3:16387355-16387377 CTCTGGAGGTGGTGGGAAAGTGG - Intronic
951672988 3:25205438-25205460 CACTGGGGATTGTTGGACAGTGG - Intronic
951833835 3:26959695-26959717 CACTGGGGCTGGTTGGACAGTGG - Intergenic
952290498 3:32010569-32010591 CACTGGGGATTGTCGGACAGTGG + Intronic
952321681 3:32283707-32283729 AAGTGTGGAGGGTGGGACAGAGG - Intronic
952713866 3:36458444-36458466 CCGTTGGGATGATGAGAAAGAGG + Intronic
952839223 3:37630295-37630317 CACTTAGGATGATGGGAAAGAGG - Intronic
952863946 3:37838922-37838944 CATTGGGAATGGTTGGACAGTGG + Intergenic
953045822 3:39293629-39293651 TAGTGAGGATGGAGGGGAAGGGG - Intergenic
953090816 3:39724406-39724428 CAGTGAGGTTAGTGGGAGAGGGG - Intergenic
953181317 3:40597602-40597624 CAGTGGGGAAGGGAGGCAAGAGG + Intergenic
953377021 3:42437157-42437179 CAGAGGGGAATGTGGGCAAGAGG - Intergenic
953583909 3:44182419-44182441 AAGTGGGTATAGTGGGGAAGGGG + Intergenic
953999062 3:47541990-47542012 AGGTGGGGAAGGTGGGGAAGTGG + Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954504431 3:51055363-51055385 AAGTGAGGAGGGTGGGAAACAGG - Intronic
954561080 3:51557011-51557033 CAGCAAGGATGATGGGAAAGGGG - Intronic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
955048797 3:55388850-55388872 CAGTGGGGAGTGTCGGACAGTGG + Intergenic
955083054 3:55675558-55675580 CTGTGGAGATGGTTGGAAAGAGG + Intronic
955135421 3:56213143-56213165 CACTGGGGATCTTCGGAAAGTGG + Intronic
955211439 3:56945245-56945267 CACTGGGGAGTGTTGGAAAGTGG + Intronic
955412703 3:58666486-58666508 AGGTGGGGAGGGTGGGAAATAGG - Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
956046113 3:65197750-65197772 CAGAGTGGATGGTGGTCAAGTGG + Intergenic
956343822 3:68255781-68255803 AAGTGGGGATGGTTGGAGATGGG + Intronic
956396672 3:68833209-68833231 CAGTGGGACTGGTTGGATAGTGG - Intronic
956473037 3:69588867-69588889 GTGTGGGGAGAGTGGGAAAGTGG - Intergenic
956589527 3:70898823-70898845 CACTGGGGATTGTTGGACAGTGG - Intergenic
956610773 3:71120691-71120713 GCGTGGGGACGGTGGGGAAGAGG + Intronic
956805640 3:72808324-72808346 CAGAGTGGGTTGTGGGAAAGTGG - Intronic
956873281 3:73439016-73439038 CACTGAGGAGGGTGGGACAGAGG - Intronic
956909005 3:73797439-73797461 ATGTGTGGATGGTGGGAAACAGG - Intergenic
956941204 3:74162978-74163000 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
956963053 3:74425229-74425251 CAGTGGGGAGGAAGGGAGAGGGG - Intronic
957061951 3:75489477-75489499 CAGTGGGGAGTGTCAGAAAGTGG - Intergenic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
957442610 3:80269728-80269750 CAGTGGGGAGGGCAAGAAAGAGG + Intergenic
957604204 3:82376309-82376331 CATTGGGGATTGTCGGACAGTGG - Intergenic
957727474 3:84086746-84086768 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
958073559 3:88646913-88646935 AAGATGGGATGGAGGGAAAGGGG + Intergenic
958257521 3:91341551-91341573 CACTGGGACTGGTGGGACAGTGG - Intergenic
958479678 3:94630737-94630759 CATTCGGGCTGGTTGGAAAGTGG + Intergenic
959642295 3:108655625-108655647 CACTGGGGATTGTTGGACAGTGG + Intronic
959736425 3:109664853-109664875 CACTGGGACTGGTTGGAAAGTGG + Intergenic
960149038 3:114232385-114232407 CAGTGGCTAGGGTGGGCAAGAGG - Intergenic
960293225 3:115912386-115912408 CAGTGGGGTTGGTGTCAAAGAGG - Intronic
960529100 3:118743298-118743320 CAGTGGGGGTGAAGGGATAGTGG - Intergenic
960653879 3:119981333-119981355 CATTGGGAATGGTTGGACAGTGG + Intronic
961162926 3:124744907-124744929 AAGAGGGGAAGGTGGGGAAGGGG + Exonic
961284512 3:125790265-125790287 CGGTGGTGGTGGTGGGAAACTGG + Intergenic
961291451 3:125849924-125849946 CAGTGGGGAGTGTCAGAAAGTGG + Intergenic
961382965 3:126507996-126508018 CACTGCGGCTGCTGGGAAAGAGG + Exonic
961427880 3:126861942-126861964 AAGTGGTGATGGTGGTGAAGAGG - Intronic
962152261 3:132905135-132905157 CAGTGAGGATGAGGAGAAAGTGG + Intergenic
962369685 3:134811029-134811051 CAGCTGGGAATGTGGGAAAGGGG - Intronic
962594252 3:136923603-136923625 CAGTGGGGTGGATGGGAGAGGGG + Intronic
962675137 3:137750811-137750833 CACTGGGGCTGGTTGGACAGTGG + Intergenic
962704159 3:138027240-138027262 TAGTGGGGATTGTGGTAAACTGG - Intronic
962761333 3:138517810-138517832 CACTGGGGAGTGTCGGAAAGTGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
962991057 3:140577895-140577917 CAGTGGGCTTTGGGGGAAAGGGG - Intergenic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963722026 3:148872802-148872824 GAGTGTGGAAGGTAGGAAAGTGG + Intronic
963858700 3:150283899-150283921 CAGTGGGGGTGAGGGGTAAGTGG + Intergenic
963980141 3:151528514-151528536 CACTGGGAATGGTTGGACAGTGG + Intergenic
964054335 3:152434194-152434216 GAGGGTGGATGGTGGGAGAGGGG - Intronic
964090606 3:152872039-152872061 CAGTGAGGATGGTGAGGATGTGG + Intergenic
964228974 3:154439586-154439608 CACTGGGGATTGTTGGACAGTGG - Intergenic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
964610604 3:158611296-158611318 CAGTAGGGAAGATGGGAAAATGG - Intergenic
965271019 3:166617551-166617573 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
965491990 3:169349072-169349094 CACTGGGGGAGGGGGGAAAGGGG - Intronic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966432681 3:179848803-179848825 CAGTGGGGATGGTGGTGCTGTGG + Intronic
966945679 3:184775603-184775625 CAGTGGTGTTGTGGGGAAAGAGG - Intergenic
967035635 3:185646675-185646697 CAGTGGGGAGGCTGGGACTGAGG + Intronic
967154180 3:186677506-186677528 CAGTGGGGATGGTGTCCATGGGG - Exonic
967932786 3:194702616-194702638 CAGAGGGGATTATGGGTAAGCGG + Intergenic
968410632 4:386824-386846 CAAGGGGACTGGTGGGAAAGTGG - Intergenic
968505060 4:967694-967716 CAGTGGAGTTGGGGGGAATGAGG + Intronic
968521476 4:1036520-1036542 CAGCGAGGATGGAGGGACAGGGG - Intergenic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968880674 4:3297471-3297493 CAGGGAGGCTGGTGGGACAGAGG - Intronic
969005843 4:4019568-4019590 CAGTGGGGAGTGTCAGAAAGTGG - Intergenic
969032452 4:4225946-4225968 CAGAGGGGCAGGTGGGAAAGTGG + Intronic
969444780 4:7238608-7238630 CAGTGGGGATGGTGGAAGCCAGG + Intronic
969807106 4:9617722-9617744 CAGTGGGGAGTGTCAGAAAGTGG + Intergenic
969970273 4:11039878-11039900 CAGTGGGCAGGGTGAGGAAGTGG - Intergenic
970012730 4:11477972-11477994 GAGAGTGGATGGTGGGAAAAAGG + Intergenic
970249021 4:14094491-14094513 TAGGAGGGCTGGTGGGAAAGGGG - Intergenic
970501287 4:16679768-16679790 CAGAGGTGAGGGTGGGCAAGGGG + Intronic
970784553 4:19780402-19780424 CACTGGGACTGGTTGGAAAGTGG - Intergenic
971059881 4:22955597-22955619 CTGATGGGAGGGTGGGAAAGTGG + Intergenic
971438716 4:26655885-26655907 CACTGGGGATTGTCGGAAAGTGG - Intronic
971656390 4:29351513-29351535 AAGTGGGGAGAGTGGGAGAGAGG - Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972492007 4:39596605-39596627 CAGTGGGGAGGGTTTGAAGGGGG - Intronic
973648100 4:52970145-52970167 CACTGGGGAGTGTTGGAAAGTGG + Intronic
973803509 4:54501263-54501285 TAGTGGGGGTGGGGGCAAAGAGG + Intergenic
973922923 4:55707766-55707788 CACTGGGGATTGTTGGACAGTGG + Intergenic
974106888 4:57479935-57479957 CAGTGGAGAAGGTGGGAACGGGG - Intergenic
974191770 4:58513755-58513777 TACTGGGGATGGAAGGAAAGAGG - Intergenic
974264067 4:59560935-59560957 CAGTGGGACTGGTTGGAGAGTGG - Intergenic
974427625 4:61760670-61760692 CACTGGGGAGTGTCGGAAAGTGG - Intronic
974470153 4:62309374-62309396 CACTGGGGTTTGTGGGACAGTGG + Intergenic
974528567 4:63077368-63077390 CATTGGGACTGGTCGGAAAGTGG - Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
975165624 4:71175320-71175342 CACTGGGGATTGTTGGACAGTGG + Intergenic
975348335 4:73319523-73319545 CACTGGGGATTGTCGGACAGTGG + Intergenic
975367263 4:73544263-73544285 CACTGGGGCTGGTTGGACAGTGG + Intergenic
975744687 4:77464609-77464631 CATTGGGACTGGTTGGAAAGTGG - Intergenic
975752082 4:77534047-77534069 CACTGGGGAGTGTCGGAAAGTGG - Intronic
975822182 4:78282893-78282915 CACTGGACATGGTGGGCAAGAGG - Exonic
976009236 4:80467450-80467472 GAGTGGGGAATGTTGGAAAGAGG - Intronic
976288983 4:83398019-83398041 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
976357492 4:84136232-84136254 CAATAGGGATTCTGGGAAAGGGG - Intergenic
976477988 4:85506752-85506774 CACTGGGGCTGGTTGGACAGTGG - Intronic
977029557 4:91864324-91864346 CACTGGGGATTGTCGGACAGTGG - Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977108719 4:92922359-92922381 CACTGGGGATTGTCGGACAGTGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977551073 4:98444526-98444548 TAATGGGGTTGGGGGGAAAGGGG - Intergenic
977580812 4:98723393-98723415 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
977593521 4:98852554-98852576 CAATTGGGATGAGGGGAAAGTGG - Intergenic
977652343 4:99485026-99485048 CAGTAGGGGTAGTGGCAAAGAGG + Intergenic
977750686 4:100606904-100606926 GACTGGGGTTGGGGGGAAAGGGG - Intronic
977897473 4:102380765-102380787 CACTGGGGAGTGTCGGAAAGTGG - Intronic
977980818 4:103319532-103319554 TAATGGGGATGGGGGGAATGTGG - Intergenic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978565432 4:110076713-110076735 CACTGGGGAGTGTTGGAAAGTGG + Intronic
978591311 4:110327819-110327841 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
979042079 4:115811787-115811809 CACTGGGGATTGTCGGACAGTGG + Intergenic
979435272 4:120680794-120680816 CAGTGGGGAAGGCTGGAAGGAGG + Intergenic
979581302 4:122364814-122364836 CATTGGGAATGGTTGGACAGTGG + Intergenic
979886064 4:126029859-126029881 CACTGGGGAATGTTGGAAAGTGG + Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981002197 4:139838807-139838829 CTGTGGGGATGCTTTGAAAGTGG - Intronic
981096640 4:140788722-140788744 CACTGGGGATTGTTGGAGAGTGG - Intergenic
981299049 4:143166570-143166592 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
981561939 4:146057667-146057689 CAGTGGTTATGGTCAGAAAGTGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
982284758 4:153723919-153723941 CACTGGGGCTGGGGGAAAAGGGG - Intronic
982340308 4:154291298-154291320 TAGTGAGGATGTTGAGAAAGGGG + Intronic
982619886 4:157691612-157691634 CACTGGGAATTGTCGGAAAGTGG + Intergenic
983109027 4:163725021-163725043 CACTGGGGATCGTTGGACAGTGG - Intronic
983627243 4:169814302-169814324 CACAGGGGATGGTAGGAAAGGGG + Intergenic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
983829121 4:172302382-172302404 CACTGGGGATTGTCGGACAGTGG - Intronic
985137477 4:186801746-186801768 GAGTGGGGGTGGTGGGAGAGAGG + Intergenic
985222979 4:187727740-187727762 CAATCTGGATGATGGGAAAGAGG + Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986402492 5:7395070-7395092 GAGCGGGGATGGCGGCAAAGGGG - Intergenic
986420555 5:7576770-7576792 CAGTGGTGTTGGTGGGGAAGGGG - Intronic
987444939 5:18006125-18006147 CATTGGGACTGGTGGGACAGTGG + Intergenic
987704711 5:21447352-21447374 CATTGGGAATGGTTGGAGAGTGG - Intergenic
987924163 5:24318285-24318307 CACTGGGAATGGTTAGAAAGTGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988187880 5:27889891-27889913 CACTGGGACTGGTTGGAAAGTGG - Intergenic
989151658 5:38305973-38305995 CAGTGGGGATGATGGGATACTGG + Intronic
989343983 5:40408559-40408581 TGATGGGGATGGTGGGAAAGGGG - Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989569438 5:42931794-42931816 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
990092620 5:52072489-52072511 AAGTAGGGAGGGTGGGAATGAGG + Intronic
990413920 5:55567894-55567916 TAGGGGGAAGGGTGGGAAAGGGG - Intergenic
990860435 5:60320495-60320517 CACTGGGGAGTGTCGGAAAGTGG - Intronic
991209413 5:64087300-64087322 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
991243504 5:64485001-64485023 CATTGGGACTGGTTGGAAAGTGG - Intergenic
991445732 5:66698359-66698381 GAGTGGGGATGGGTGGAAAGGGG - Intronic
991496368 5:67230194-67230216 CACTGGGGATTGTAGGACAGTGG - Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992388684 5:76310642-76310664 CAATGGAGGTGGTGAGAAAGTGG + Intronic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992659583 5:78945291-78945313 CACTGGGGATTGTTGGACAGTGG - Intronic
992826513 5:80554672-80554694 AAGGGGGAAAGGTGGGAAAGGGG + Intergenic
994014955 5:94955074-94955096 CAGTGGGACTGGTTGGACAGTGG + Intronic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994266621 5:97723760-97723782 CACTGGGGATTGTCGGACAGTGG - Intergenic
994289175 5:98007692-98007714 CAGGGGGCATGGTGGTACAGGGG + Intergenic
994297950 5:98113564-98113586 CACTGGGGATTGTCGGACAGTGG + Intergenic
994430276 5:99650060-99650082 CAGTGGGGATGTGGTGAAAAGGG + Intergenic
994618865 5:102138796-102138818 GAGTGGGGAGGGTGGGAGAAGGG - Intergenic
995203862 5:109457369-109457391 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
996114100 5:119599439-119599461 CACTGGGGAGTGTCGGAAAGTGG + Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996420776 5:123259290-123259312 CACTGGGGCTGGTTGGACAGTGG - Intergenic
996836897 5:127803684-127803706 CCGTTGGGATGGAGGTAAAGAGG - Intergenic
997117307 5:131138908-131138930 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
997193720 5:131963359-131963381 CAGTGGCGGTGAGGGGAAAGAGG - Intronic
997238447 5:132289441-132289463 CAGTGGGGATGGTAGGACCCTGG + Intronic
997467130 5:134095799-134095821 CAGTGGGGCTGGTGTGACCGAGG - Intergenic
997861724 5:137423796-137423818 CACTGGGGAGTGTTGGAAAGTGG - Intronic
998002128 5:138633692-138633714 GGATGGGGATGGTGGGAATGGGG - Intronic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998218077 5:140252656-140252678 CAATGGGGATGTTTGGCAAGAGG + Intronic
998377467 5:141700750-141700772 TAGTGGGGAATGTGGGACAGAGG - Intergenic
998411599 5:141915370-141915392 CAGAGGGGATGGTGGGACTCAGG + Intergenic
998542007 5:142991462-142991484 CAGTGGGGCTTGTTGGACAGTGG - Intronic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000790205 5:165597381-165597403 CAGTCGGGATGTTGAGAAATGGG - Intergenic
1001064182 5:168522711-168522733 CAGTGGGGGGGGTGGGATTGGGG - Intergenic
1001076319 5:168630813-168630835 CACTGGGACTGGTCGGAAAGTGG + Intergenic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001281416 5:170389072-170389094 CAGTGGGGAGGGTGGCACAGTGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001987152 5:176084183-176084205 CATTGGGGATTGTAGGACAGTGG - Intronic
1002229716 5:177753964-177753986 CATTGGGGATTGTCGGACAGTGG + Intronic
1002265629 5:178029813-178029835 CATTGGGGATTGTCGGAGAGTGG - Intronic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1004180309 6:13375696-13375718 CAAAGGGGTTGGTGGGATAGGGG - Intronic
1004987166 6:21095558-21095580 GAGGGGGGTTGGGGGGAAAGGGG - Intronic
1005252682 6:23965463-23965485 AAGTAGGGAAGGTGGGAGAGAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1006255176 6:32827069-32827091 CAGTGAGGATGGGGTGAGAGTGG - Intronic
1006302106 6:33199265-33199287 CAGTGGGGGTGGTGGCATCGGGG + Exonic
1006397561 6:33797025-33797047 GAGTGGATATGGGGGGAAAGGGG + Intronic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007075326 6:39062533-39062555 CAGTTGGGAGGGTGGGGAGGTGG - Intronic
1007094223 6:39203528-39203550 CAGGGGTGATGGGGGGGAAGTGG - Intronic
1007155230 6:39736519-39736541 CACTGGGGATTGTCGGACAGTGG + Intergenic
1007271780 6:40643144-40643166 CATTGGGGATCATGGGCAAGTGG - Intergenic
1007327353 6:41072796-41072818 CACTGGGGGTGGTGTCAAAGCGG + Intronic
1007378091 6:41469978-41470000 CAGTGAGAAAGGTGGGGAAGAGG + Intergenic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1007824554 6:44590180-44590202 CACTGGGGCTTGTGGGACAGTGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008436911 6:51486416-51486438 CACTGGGAATGGTCAGAAAGTGG - Intergenic
1008447658 6:51611464-51611486 GAGTGGGCATGGTGTGTAAGTGG + Intergenic
1008449058 6:51628219-51628241 GAGTGGGGAAGGTGGGAGGGGGG - Intronic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008671513 6:53774142-53774164 CAATGGGGAGTGTTGGAAAGTGG + Intergenic
1008698734 6:54073141-54073163 CAGTGGGGTTGGCCTGAAAGTGG + Intronic
1008874182 6:56307736-56307758 CACTGGGGAGTGTCGGAAAGCGG - Intronic
1008997784 6:57679472-57679494 CACTGGGACTGGTGGGACAGTGG + Intergenic
1009186276 6:60578810-60578832 CACTGGGACTGGTGGGACAGTGG + Intergenic
1009338823 6:62528206-62528228 CAGTGGGGATTTTTGGAGAGTGG + Intergenic
1009926270 6:70124936-70124958 CAGTGTGGGTGCTGGGAAAGTGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010102541 6:72125995-72126017 CACTGGGAATGGTTGGACAGTGG - Intronic
1010274504 6:73953500-73953522 CAGGGGGAATGGTGGAAGAGAGG - Intergenic
1010310500 6:74378947-74378969 CACTGGGGATTGTCGGACAGTGG - Intergenic
1010560712 6:77345493-77345515 TAGTGGGGAGGGGAGGAAAGGGG + Intergenic
1010670019 6:78676080-78676102 CATTGGGATTGGTTGGAAAGTGG + Intergenic
1010869308 6:81018076-81018098 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
1010931207 6:81805569-81805591 CAGTGTTGATGGTGGAACAGTGG - Intergenic
1011335313 6:86253460-86253482 CACTGGGGATGGTCGGACAGTGG + Intergenic
1011841073 6:91499574-91499596 GAGTGGGGGTGGGGAGAAAGAGG + Intergenic
1011909653 6:92420869-92420891 CATTGGGACTGGTCGGAAAGTGG + Intergenic
1011970061 6:93211439-93211461 GAGTGGGGAAGTGGGGAAAGGGG + Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013860898 6:114633988-114634010 CAGTGGGACTGGTTGGACAGTGG - Intergenic
1013933742 6:115568536-115568558 CCGGGGGGAGGGTGGGAGAGGGG + Intergenic
1013964110 6:115935157-115935179 CAGTGGGACTGGTTGGACAGTGG + Exonic
1014220759 6:118796419-118796441 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015325195 6:131916815-131916837 AAGAGGTGATGGTGGGAGAGTGG - Intergenic
1015954581 6:138586703-138586725 TAGTGGGGAGAGTGTGAAAGAGG + Intronic
1016076849 6:139805526-139805548 CTGTGGGGATGGGGGGCCAGGGG + Intergenic
1016215667 6:141599466-141599488 TAGTGGGGATCATGGGAAAAAGG - Intergenic
1016403012 6:143700561-143700583 CAGTGGGGAGGGGGGGCGAGAGG + Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016856089 6:148671723-148671745 CACTGGGACTGGTTGGAAAGTGG - Intergenic
1017653489 6:156604812-156604834 CACTGGGGATTGTCGGACAGTGG + Intergenic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018076070 6:160214749-160214771 CATTGGGACTGGTGGGACAGTGG - Intronic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019210138 6:170398056-170398078 CAGATGGGAGGATGGGAAAGAGG + Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019640817 7:2102720-2102742 CAGTGGTGATGGTGGGGACGTGG - Intronic
1019643712 7:2118093-2118115 CAGGGTGGAGGGTGGGTAAGGGG - Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020619523 7:10501067-10501089 CACTGGGGATTGTCGGACAGTGG + Intergenic
1020757893 7:12226604-12226626 CTGTGGTGGTGGTTGGAAAGAGG + Intronic
1020874712 7:13678168-13678190 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1021156315 7:17215330-17215352 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1021201690 7:17734824-17734846 CACTGGGGATTGTTGGACAGTGG + Intergenic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021752134 7:23812658-23812680 AAGGTGGGAGGGTGGGAAAGGGG - Intronic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1021925034 7:25526048-25526070 AACTGGGGCTGGAGGGAAAGGGG + Intergenic
1022031033 7:26492013-26492035 CAGTGAGGAGGGTGGGAGACAGG + Intergenic
1022483734 7:30761295-30761317 CTGTGGGGGAGGTGGGGAAGAGG + Intronic
1022879911 7:34575912-34575934 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1022933853 7:35151930-35151952 CACTGGGGATTGTCGGAAAGTGG + Intergenic
1023142894 7:37120267-37120289 CACTGGGGATTGTCGGACAGTGG + Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1025164161 7:56695975-56695997 CAGTGGAGATGGGTGGTAAGTGG - Intergenic
1025706121 7:63866096-63866118 CAGTGGAGATGGGTGGTAAGTGG + Intergenic
1025869168 7:65414900-65414922 CACTGGGGATTGTCGGACAGTGG + Intergenic
1026405677 7:70063089-70063111 GGGTGGGGATGTTGGGAAAGGGG - Intronic
1026505462 7:70979156-70979178 CAGGCAGGGTGGTGGGAAAGTGG + Intergenic
1026790053 7:73325620-73325642 CAGGGGTGTTGCTGGGAAAGGGG - Intronic
1027449269 7:78311275-78311297 CAGTGGGGAGGGTGGAAAAGAGG + Intronic
1027790302 7:82633207-82633229 CACTGGGACTGGTTGGAAAGTGG + Intergenic
1028078784 7:86548282-86548304 CACTGGGACTGGTCGGAAAGTGG - Intergenic
1028630364 7:92927012-92927034 CACTGGGAATGGTTGGACAGTGG - Intergenic
1029310614 7:99660078-99660100 CAATGGGGATTGTTGGAGAGTGG - Intronic
1029325470 7:99803618-99803640 CACTGGGGATTGTTGGACAGTGG - Intergenic
1029443826 7:100602283-100602305 CAATGGGGAAGGCGGGACAGTGG - Exonic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029829785 7:103244710-103244732 CACTGGGGATTGTCGGAAAGTGG + Intergenic
1029857479 7:103532277-103532299 CACTGGGGCTTGTTGGAAAGTGG + Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1029979419 7:104864241-104864263 CACTGGGGAGTGTTGGAAAGTGG + Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030451541 7:109719235-109719257 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1030595648 7:111535763-111535785 CAGTGGTGACTGTGGGAAAAGGG + Intronic
1031861990 7:126990468-126990490 CAATGGGAATGGTGGAACAGAGG + Intronic
1031920249 7:127595125-127595147 ATGAGGGGATAGTGGGAAAGTGG + Intronic
1032225994 7:130032300-130032322 CAGTGGGGATGGTGGAGGAAGGG - Intronic
1032405687 7:131653733-131653755 CGGTGGAGATGGGGGGACAGTGG + Intergenic
1032440938 7:131942704-131942726 CACTGGGGATGATGAGACAGTGG + Intergenic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033584231 7:142762405-142762427 CTGTGGAGATTGTGGGAAAGAGG + Intronic
1034028892 7:147738031-147738053 CACTGGGGATTGTTGGACAGTGG - Intronic
1034036973 7:147835177-147835199 CAGTGGGGATGGTGGTGGTGGGG - Intronic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1035024124 7:155815318-155815340 CAGCAGGGATGCTGGGCAAGGGG - Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1035886277 8:3294837-3294859 CACTGGGGAGTGTCGGAAAGTGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037598333 8:20373274-20373296 CCCTGTGGATGATGGGAAAGTGG - Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038344886 8:26723307-26723329 CAGTAGGGGTAGTGGGAGAGAGG + Intergenic
1038877322 8:31566221-31566243 CACTGGGGAGTGTAGGAAAGTGG + Intergenic
1038928913 8:32171474-32171496 CACTGGGGAATGTTGGAAAGTGG + Intronic
1039154036 8:34535510-34535532 CAGTGGGACTGGTTGGACAGTGG + Intergenic
1039284475 8:36026173-36026195 CACTGGGAATGGTTGGACAGTGG + Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039492581 8:37959073-37959095 CAGAGGGTATGATGGGGAAGGGG - Intergenic
1040098954 8:43480184-43480206 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1040363650 8:46691910-46691932 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1040439093 8:47422622-47422644 CACTGGGGATGGTCAGACAGTGG - Intronic
1040454185 8:47579706-47579728 GGGTGGGGATGGTGGGGTAGAGG - Intronic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1040992657 8:53369124-53369146 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041387430 8:57319231-57319253 CACTGGGGATTGTCGGACAGTGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041750455 8:61254919-61254941 CACTGGGGATTGTCGGAGAGTGG - Intronic
1041845433 8:62322341-62322363 CACTGGGGAGTGTTGGAAAGTGG - Intronic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042630264 8:70808424-70808446 CACTGGGGATTGTTGGACAGTGG + Intergenic
1043089232 8:75876331-75876353 CATTGGGACTGGTCGGAAAGTGG - Intergenic
1043254472 8:78116591-78116613 CACTGGGGATTATGGGAAATAGG + Intergenic
1043374627 8:79634849-79634871 GAGTGGGTATCTTGGGAAAGAGG - Intronic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044134881 8:88574201-88574223 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1044224934 8:89708297-89708319 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1044561550 8:93617460-93617482 AAGTGAGAAGGGTGGGAAAGAGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044876802 8:96676822-96676844 CAGTAGGGAAGGTTGGAAAGGGG - Intronic
1045147972 8:99369156-99369178 TTGTGGTGATAGTGGGAAAGAGG - Intronic
1045177219 8:99738951-99738973 CACTGGGGAGTGTTGGAAAGTGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045360217 8:101425893-101425915 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1045419476 8:102000012-102000034 CACTGGGGATTGTCGGACAGTGG + Intronic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045646971 8:104308700-104308722 CATTGGGGCTGGTTGGACAGTGG + Intergenic
1045879566 8:107021759-107021781 GAATGGGGAGGGTGGGAGAGAGG + Intergenic
1046097856 8:109581357-109581379 CTGTGAGGAAGGTAGGAAAGGGG - Intronic
1046437581 8:114212228-114212250 GAATGGGGGTGGAGGGAAAGAGG + Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1046825871 8:118690787-118690809 AAGTGGGGAGGGTGGAAAAAGGG - Intergenic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047230791 8:122996290-122996312 CCTCGGGGGTGGTGGGAAAGCGG - Intergenic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048275551 8:133063106-133063128 CACTGGAGATGGTGGCAAATGGG - Intronic
1049155988 8:141067178-141067200 GAGTGGGGCAGGTGGGACAGAGG + Intergenic
1049294281 8:141822528-141822550 CAGTAGTCATGCTGGGAAAGAGG - Intergenic
1049378534 8:142300938-142300960 CAGAGGGGAGGGTGGGCAGGAGG + Intronic
1050012185 9:1196127-1196149 CACTGGGGATTGTTGGAAAGTGG - Intergenic
1050034908 9:1424734-1424756 CATTGGGGATTGTCGGACAGTGG - Intergenic
1050329472 9:4531184-4531206 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1051245091 9:15101835-15101857 CAATGGGGGTGGTGAGGAAGTGG + Intergenic
1051301379 9:15654777-15654799 CACTGGGGAGTGTTGGAAAGTGG + Intronic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1051363329 9:16301646-16301668 GGCTGGGGGTGGTGGGAAAGGGG + Intergenic
1051614789 9:18997080-18997102 CATTGGGAATGGTTGGACAGTGG + Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1052328142 9:27239484-27239506 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1053313961 9:37036661-37036683 CAGGGGAGAGGGTGGGCAAGGGG - Intergenic
1055053264 9:72000498-72000520 CATTGGGACTGGTCGGAAAGTGG - Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055386036 9:75763036-75763058 CACTGGGGATTGTTGGATAGTGG - Intergenic
1055548502 9:77408419-77408441 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1055578972 9:77688263-77688285 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1056277075 9:85003803-85003825 CAGTGAAGATGGGGGGAATGGGG + Intronic
1056426354 9:86481034-86481056 CACTGGGGCTGGTTGGACAGTGG - Intergenic
1056668022 9:88597430-88597452 CATTGGGACTGGTTGGAAAGTGG + Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057456300 9:95215398-95215420 GAGTGAGGAGGATGGGAAAGAGG + Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058698829 9:107584388-107584410 GACTAGGGAGGGTGGGAAAGTGG - Intergenic
1058698990 9:107585534-107585556 GACTAGGGAGGGTGGGAAAGTGG + Intergenic
1058926171 9:109666195-109666217 CACTGGGGCTGGTTGGAGAGTGG - Intronic
1058962607 9:110006039-110006061 CACTGGGGATTGTTGGACAGTGG - Intronic
1059763628 9:117362700-117362722 CAGTGGTGGTGGTGGTGAAGAGG - Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060339255 9:122759134-122759156 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1060550692 9:124483698-124483720 CAGTGGTGATGGTGGCAGAGTGG - Intronic
1060904030 9:127288359-127288381 AAGTGGGGATGCTGGAATAGAGG + Intronic
1060944065 9:127559662-127559684 CAGATGGGCAGGTGGGAAAGTGG + Intronic
1061499585 9:130994173-130994195 GAGTGGGGAGGGTGGAAAAGGGG - Intergenic
1062191537 9:135250250-135250272 CACTGGGGATGGTGGGGATGAGG + Intergenic
1062216229 9:135391138-135391160 CAGTCGGGAGGGTGGGAATGTGG + Intergenic
1062318198 9:135978380-135978402 CAGGGGGGATGGTGGGGGATGGG - Intergenic
1062415415 9:136446830-136446852 GAGCGGGTACGGTGGGAAAGGGG - Intronic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186571015 X:10715173-10715195 CACTGGGGATTGTTGGACAGTGG + Intronic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187397331 X:18930244-18930266 CAGTGGTGATGGTGGTAGCGTGG - Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187453158 X:19417172-19417194 CACTGGGGAGTGTTGGAAAGTGG + Intronic
1187500344 X:19833595-19833617 CGAGGTGGATGGTGGGAAAGAGG - Intronic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187838455 X:23459445-23459467 CATTGGGGATTGTCGGACAGTGG - Intergenic
1187987959 X:24834968-24834990 AATAGGGGAAGGTGGGAAAGAGG - Intronic
1188154571 X:26725009-26725031 ACATGGGGAGGGTGGGAAAGGGG - Intergenic
1188250440 X:27887115-27887137 AAGTGGGGAAGGTGAGAAGGAGG - Intergenic
1189062404 X:37768724-37768746 CACTGGGGAGTGTCGGAAAGTGG + Intronic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189780208 X:44506763-44506785 CGCTGGGGAAGGAGGGAAAGGGG + Intergenic
1190020230 X:46867637-46867659 CAGTGGGGTGGGGGGGAATGTGG - Intronic
1190145753 X:47890275-47890297 CAGTGGGGGTGTTGGAAATGTGG - Intronic
1190260720 X:48795241-48795263 GAGTGGGAATGTTGGGGAAGGGG - Intergenic
1190497021 X:51036518-51036540 GAATGGGGAGGGTGGGAGAGGGG - Intergenic
1190508965 X:51157599-51157621 GAATGGGGAGGGTGGGAGAGGGG + Intergenic
1190590696 X:51997288-51997310 CACTGGGGAGTGTTGGAAAGTGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191076710 X:56461120-56461142 CACTGGGGATTGTCGGACAGTGG - Intergenic
1191588781 X:62858198-62858220 CACTGGGGATTGTTGGACAGTGG + Intergenic
1191635081 X:63367546-63367568 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1191748191 X:64513082-64513104 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1191828327 X:65389646-65389668 CACTGGGGAGTGTTGGAAAGTGG - Intronic
1191882463 X:65856665-65856687 CATTGGGACTGGTCGGAAAGTGG - Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1191969233 X:66795035-66795057 CACTGGGGATTGTTGGACAGTGG - Intergenic
1192284387 X:69719493-69719515 AAGTGGGGAGGGTGAGAGAGTGG - Intronic
1192556087 X:72090663-72090685 AAGTGGGGATGGGGGGTTAGGGG - Intergenic
1192985711 X:76396458-76396480 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1193112731 X:77745615-77745637 TAATGGGGATGGTGGCACAGTGG + Intronic
1193154419 X:78157894-78157916 CACTGGGGAGTGTGGGAAAGCGG - Intergenic
1193363217 X:80599709-80599731 CACTGGGGATTGTTGGACAGTGG - Intergenic
1193787146 X:85772899-85772921 CACTGGGGATTGTCGGACAGTGG - Intergenic
1193811319 X:86054728-86054750 CAATGGGGATTGTCGGACAGTGG - Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194438478 X:93899432-93899454 AAGTTGGGAGGGTGGTAAAGTGG - Intergenic
1195118746 X:101727763-101727785 AAGAGTGGATGGTGAGAAAGTGG - Intergenic
1195351280 X:103998746-103998768 CATTGGGACTGGTTGGAAAGTGG - Intergenic
1195395819 X:104409233-104409255 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1195547305 X:106126852-106126874 CATTGGGGCTGGTTGGACAGTGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195735812 X:108011525-108011547 CACTGGGGATTGTTGGACAGTGG + Intergenic
1195932907 X:110096687-110096709 CACTGGGGATTGTTGGACAGTGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196175087 X:112631385-112631407 GATTGGAGAGGGTGGGAAAGGGG - Exonic
1196658179 X:118241814-118241836 CACTGGGGATTGTCGGACAGTGG + Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197215188 X:123860326-123860348 GAGAGGGGAAGGAGGGAAAGCGG - Intronic
1197542918 X:127788910-127788932 CACTGGGGATTGTTGGACAGTGG + Intergenic
1197667653 X:129240969-129240991 CAATGGGGAGTGTCGGAAAGTGG + Intergenic
1197707604 X:129646027-129646049 CCGTGGGGAAGGGGAGAAAGTGG - Exonic
1197914947 X:131524594-131524616 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1198035831 X:132800579-132800601 CATAGGGGATGGTGGGAGTGAGG - Intronic
1198135630 X:133747256-133747278 CAGTGCCGGTGGTGAGAAAGAGG - Intronic
1198373195 X:136011749-136011771 GGGTGGGGACGGTAGGAAAGAGG + Intronic
1198489255 X:137122532-137122554 CACTGGGGAGTGTCGGAAAGCGG + Intergenic
1198615627 X:138455958-138455980 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1199180943 X:144853757-144853779 CACTGGGACTGGTTGGAAAGTGG + Intergenic
1199302955 X:146233968-146233990 CATTGGGATTGGTTGGAAAGTGG - Intergenic
1199336486 X:146623665-146623687 CATTGGGGTTGGTGGCAAAAAGG - Intergenic
1199617843 X:149671816-149671838 CTGTGGTGATGGTGGGGGAGGGG + Intergenic
1199624799 X:149731433-149731455 CTGTGGTGATGGTGGGGGAGGGG - Intergenic
1199709002 X:150454831-150454853 CAATTGGGATGGTGGGATGGTGG - Intronic
1199716173 X:150508661-150508683 CAGTGGGGCTGGTGGGAGTGGGG - Intronic
1199884528 X:152006883-152006905 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200318828 X:155163199-155163221 CAATGGGGATTGTCGGACAGTGG - Intergenic
1200655692 Y:5899450-5899472 CAGGGGGAAGGGTTGGAAAGAGG + Intergenic
1201249233 Y:12039494-12039516 CACTGGGGAGTGTTGGAAAGTGG + Intergenic
1201474952 Y:14370646-14370668 TAGTGGGGGTGGTGGTGAAGGGG - Intergenic
1201670033 Y:16509644-16509666 GAGGGGAAATGGTGGGAAAGTGG - Intergenic
1201975089 Y:19840108-19840130 CACTGGGGAGGGTTGGACAGTGG - Intergenic
1202165879 Y:21987270-21987292 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1202225479 Y:22599102-22599124 CACTGGGGAGTGTCGGAAAGTGG + Intergenic
1202317634 Y:23596559-23596581 CACTGGGGAGTGTCGGAAAGTGG - Intergenic
1202351419 Y:23996621-23996643 CACTGGGAATGGTTGGACAGTGG + Intergenic
1202519360 Y:25673498-25673520 CACTGGGAATGGTTGGACAGTGG - Intergenic
1202553132 Y:26073499-26073521 CACTGGGGAGTGTCGGAAAGTGG + Intergenic