ID: 900317700

View in Genome Browser
Species Human (GRCh38)
Location 1:2067622-2067644
Sequence CCCCCGTGCCACCACCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900317700_900317707 5 Left 900317700 1:2067622-2067644 CCATGAGGGTGGTGGCACGGGGG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 900317707 1:2067650-2067672 ATGAGGGGCCGCAGGTGCCTCGG 0: 1
1: 0
2: 1
3: 16
4: 170
900317700_900317708 6 Left 900317700 1:2067622-2067644 CCATGAGGGTGGTGGCACGGGGG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 900317708 1:2067651-2067673 TGAGGGGCCGCAGGTGCCTCGGG 0: 1
1: 0
2: 3
3: 25
4: 215
900317700_900317704 -10 Left 900317700 1:2067622-2067644 CCATGAGGGTGGTGGCACGGGGG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 900317704 1:2067635-2067657 GGCACGGGGGTCCGCATGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 113
900317700_900317705 -3 Left 900317700 1:2067622-2067644 CCATGAGGGTGGTGGCACGGGGG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 900317705 1:2067642-2067664 GGGTCCGCATGAGGGGCCGCAGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900317700 Original CRISPR CCCCCGTGCCACCACCCTCA TGG (reversed) Intronic
900294806 1:1943494-1943516 CCCCTGTGCCACCAGCACCAAGG - Intronic
900317700 1:2067622-2067644 CCCCCGTGCCACCACCCTCATGG - Intronic
900318418 1:2070672-2070694 CCCCCATGGCTCCACCCACATGG - Intronic
902226162 1:14997697-14997719 CCCCTGCTCCTCCACCCTCAGGG - Intronic
903332088 1:22601499-22601521 CCCCCCTGCCCCCACACGCATGG - Intronic
904024465 1:27493520-27493542 CCCCACTGCCACCACCCCCATGG - Intergenic
905240911 1:36580881-36580903 CCCTCCTCCCACCACCCTCCTGG - Intergenic
905477949 1:38242142-38242164 TCCCCTTCCCTCCACCCTCAGGG + Intergenic
905782023 1:40720315-40720337 CCCCTGTCCCACCACCCCCCTGG + Intronic
906761833 1:48383351-48383373 CCCCCCCGCCACCTCCCTCCCGG + Intronic
906953041 1:50349793-50349815 CCCCAGTGCCTGGACCCTCAGGG + Intergenic
908644830 1:66265960-66265982 CCCCCGACACCCCACCCTCATGG - Intronic
909238788 1:73185094-73185116 TCCCTGTGCCATCACCATCAAGG + Intergenic
909391455 1:75125843-75125865 CCCCAGTCCCGCCATCCTCAAGG + Intergenic
910370960 1:86514585-86514607 CCCCTTTGGCAACACCCTCAAGG - Intergenic
910565236 1:88636151-88636173 CCCCAGTGTCACCAAACTCAAGG + Intergenic
911179335 1:94847351-94847373 CCTCCCTGCCACCCTCCTCAAGG - Intronic
913011416 1:114687562-114687584 CCCCCATCCCACCAGCTTCATGG - Intronic
915539214 1:156557148-156557170 CCCCCCCGCCACCTCCCTCCCGG - Intronic
917966129 1:180179821-180179843 CCCCTGTGCCTCCTCTCTCAGGG - Intronic
923220543 1:231888771-231888793 CCCCAGTGCCCCCATCCACAGGG + Intronic
1063464533 10:6234145-6234167 CCCCCGTCCCACCTACCCCAGGG - Exonic
1063935548 10:11074004-11074026 CCTCCGTGCCACAGCCCTCGAGG + Intronic
1065079235 10:22111302-22111324 CCCCCCCCCCACCACCCCCAAGG - Intergenic
1065846451 10:29747528-29747550 CCCCACCACCACCACCCTCATGG - Intergenic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070439874 10:76432922-76432944 CACCAGTGCCACCACCCTAATGG + Intronic
1076109251 10:127848675-127848697 CTTCCCTGGCACCACCCTCACGG + Intergenic
1077212949 11:1382000-1382022 CCCCCCTGCCACCCCCAGCAAGG + Intergenic
1077391497 11:2302530-2302552 CCCCTGTGCCAGCACCCTCCGGG - Intronic
1077442456 11:2575001-2575023 CCACCTTGCCACCAGCCTCCCGG - Intronic
1077490305 11:2858011-2858033 CCCCCCTGCCACCATCCTTGAGG + Intergenic
1077563495 11:3281184-3281206 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1077569387 11:3326999-3327021 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1078780554 11:14434916-14434938 CCCCCCTCCCCCCAACCTCATGG - Intergenic
1081570527 11:44287804-44287826 CCCCCTTGCAACAACCTTCAAGG + Intronic
1081592405 11:44433673-44433695 CCCACTTGGCACCACCCTGAAGG - Intergenic
1081688305 11:45057947-45057969 CTCCTGTGCCCCCACCCCCAGGG - Intergenic
1082063396 11:47879539-47879561 CCCCTGTGCCTCCACCTTCAGGG + Intergenic
1082891917 11:58148560-58148582 CCCCAATGCCACCATCCCCATGG + Intronic
1083713137 11:64560829-64560851 CCCTCCTGCCACCACCCTACTGG + Intronic
1084194491 11:67516692-67516714 CCTTCCTTCCACCACCCTCACGG - Intergenic
1084519652 11:69655546-69655568 TCCCGGAGCCCCCACCCTCAGGG - Intronic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1086989333 11:93286307-93286329 CTCCCCTGCAACCACCCTCATGG + Intergenic
1087946364 11:104164560-104164582 CCCACATCCCACCACCATCAAGG - Intergenic
1089456426 11:118628340-118628362 GCCCCGTGCCCCCAGCGTCAGGG - Exonic
1089527104 11:119104371-119104393 CCTCCCTACCACCACCCTCCTGG + Intronic
1089563371 11:119357084-119357106 CCCCCCTCCCACCCCCCGCACGG - Intronic
1089564449 11:119363614-119363636 CCCCCTTGCCCCCTCCCTCTCGG - Intronic
1090482153 11:127078255-127078277 CCCCCGTGACACCAAGCCCATGG - Intergenic
1091761863 12:3092910-3092932 CCTCCCTGCCACCACGCCCAGGG + Intronic
1097907076 12:64931488-64931510 CTCCCCTGTCACCACCATCAGGG - Intergenic
1099234556 12:80068296-80068318 TCCCCTTGCCACCTCCCTGAGGG + Intergenic
1100863527 12:98832028-98832050 CCCTCGGTCCATCACCCTCAGGG - Exonic
1108888261 13:55218839-55218861 CCCCTTTGACACCACCCTTATGG - Intergenic
1113707825 13:112445679-112445701 CCCCTCTGCCTTCACCCTCAGGG + Intergenic
1113847795 13:113402556-113402578 CACCAGTGGCACCACCCACAGGG + Intergenic
1114654781 14:24309714-24309736 CCCCAGTCACTCCACCCTCAGGG - Intronic
1115951243 14:38724635-38724657 CTCTCCAGCCACCACCCTCAAGG + Intergenic
1117449465 14:55836952-55836974 CCCTGGTGCCATCACCCTCCTGG - Intergenic
1118312625 14:64704803-64704825 CCCCCGTGCCAGCCCCCTGCGGG + Intronic
1118442695 14:65826626-65826648 CCCCAGTGCCACCGTCCCCAGGG + Intergenic
1122296074 14:100706379-100706401 TCTCCATGCCACCACCCTCGAGG - Intergenic
1122329714 14:100904220-100904242 CCCCATTCCCACCACCCTCCTGG + Intergenic
1122835422 14:104428404-104428426 CACCCCTGCCCCCGCCCTCAAGG - Intergenic
1123057373 14:105577730-105577752 CCTCTGGGCCACCAGCCTCATGG - Intergenic
1124619928 15:31267879-31267901 CCACAGGGCCACCACCCTCAGGG - Intergenic
1125115940 15:36091699-36091721 CCCCTGTCCCAGCAGCCTCAGGG - Intergenic
1127730873 15:61800884-61800906 CTCCAGTCCCACTACCCTCAGGG - Intergenic
1128213340 15:65917216-65917238 CCCCCGAGCCTCCCCTCTCAGGG + Intronic
1132288646 15:100684145-100684167 CCTCCCAGCCTCCACCCTCAAGG + Intergenic
1132497409 16:270451-270473 CCTCCATGTCCCCACCCTCAAGG - Intronic
1132540531 16:506617-506639 CCCCCAAGCCCTCACCCTCACGG + Intronic
1133054437 16:3138482-3138504 CCTCCGTGCCCCCACCGTCGGGG - Exonic
1133102277 16:3486592-3486614 CCCTCCTGCCAGCACCGTCAAGG - Exonic
1133744116 16:8674471-8674493 CCCGCCTGCCACCTCCCTCCTGG + Intergenic
1136630865 16:31488582-31488604 CCCCAGTGGCCCCAGCCTCACGG + Intronic
1136682347 16:31975708-31975730 CCCCCGTGCCACTCACCTCCAGG - Intergenic
1136782606 16:32916876-32916898 CCCCCGTGCCACTCACCTCCAGG - Intergenic
1136887189 16:33936974-33936996 CCCCCGTGCCACTCACCTCCAGG + Intergenic
1137611481 16:49821243-49821265 CCCCCGCCCCACCACCCTGTGGG - Intronic
1139483107 16:67241484-67241506 CCCCAGAGCCACCCCCGTCAGGG + Intronic
1141957649 16:87383390-87383412 CCCCCGCGCGCTCACCCTCACGG + Exonic
1142324905 16:89408458-89408480 GCCACTTGCCACCACGCTCAGGG - Intronic
1203085263 16_KI270728v1_random:1180864-1180886 CCCCCGTGCCACTCACCTCCAGG - Intergenic
1143240579 17:5439785-5439807 ACCCTGGGCCACCACCCTCCAGG - Intronic
1143871375 17:9959327-9959349 CCCCAGCGCCTCCACCCTCAGGG - Intronic
1144755174 17:17675726-17675748 CCACCGTGCCACCAACAGCACGG - Intergenic
1145002252 17:19313442-19313464 ACACCATGCCACCATCCTCAAGG - Intronic
1145888049 17:28396413-28396435 CCCCCTGTCCCCCACCCTCATGG + Exonic
1146183985 17:30713059-30713081 CCCCCATGGCACCCCCCGCATGG - Intergenic
1147131684 17:38413363-38413385 CCCCACTGCCACCTCCCTCCTGG - Intergenic
1147138961 17:38451079-38451101 CCCCTCCGCCACCACCCTCTGGG + Intronic
1147142867 17:38469046-38469068 CCCCCGTGCCACTCGCCTCCAGG - Intronic
1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG + Exonic
1147177385 17:38664266-38664288 CCCCCCTGCCTCTACCCCCAGGG + Intergenic
1147265408 17:39231607-39231629 GCCCCGTGTCCCCAGCCTCAAGG - Intergenic
1148108290 17:45130917-45130939 CCCCTGTTCCCCCACCCCCAAGG + Intronic
1148183009 17:45620413-45620435 CACTCGTGCCCCCACCCCCAGGG - Intergenic
1148265845 17:46225278-46225300 CACTCGTGCCCCCACCCCCAGGG + Intronic
1148351855 17:46946987-46947009 CCCCCGTCCCACCTTCCCCAGGG - Intronic
1149660724 17:58332757-58332779 CCCCCGTGGCACCAGCTCCAAGG + Intergenic
1151365153 17:73612238-73612260 CCCACGGTCCCCCACCCTCACGG + Intronic
1151421471 17:74000872-74000894 CCCCCCCACCACCACCTTCAGGG + Intergenic
1151547547 17:74802322-74802344 CCCCCGTGCCACCGCCTCTATGG + Intronic
1151629611 17:75301595-75301617 CCACCATGCCACAACCCTTAGGG + Intergenic
1152269487 17:79315738-79315760 CGCCCGTGCCGCCACCCTGGGGG + Intronic
1152278078 17:79369612-79369634 CTCCCCTGCCACCACCATCTTGG + Intronic
1152297775 17:79478297-79478319 CACCCCGGCCCCCACCCTCAGGG - Intronic
1152364014 17:79844833-79844855 CCCCCGAGCCCCCAACCCCAGGG + Intergenic
1152544489 17:80993865-80993887 CCCAAGTGCCACCAGCCACACGG - Intronic
1152567362 17:81106305-81106327 CCACCATGCCTCCACCCTGAAGG - Intronic
1152585821 17:81189044-81189066 CCCCAGTGCCCCCATCCTCATGG + Intergenic
1154154187 18:11930896-11930918 CCCCAGGGCCACCACCCTTCAGG + Intergenic
1155152631 18:23135268-23135290 CCCCCGCCCCACCACCCGCTCGG + Intronic
1159959792 18:74546545-74546567 CTCTCGTGCCACCCCCCTGAGGG + Intronic
1160149117 18:76385861-76385883 CCCCGGTGCCAGGACCCTCGTGG + Intronic
1160680375 19:409277-409299 CCTCCCTGCCACCAGCCTCCGGG - Intergenic
1160727600 19:624518-624540 CCCCTGAGCCCACACCCTCAGGG + Intronic
1160745094 19:707750-707772 CCCCCCTGCCCCCACCCTTAAGG - Intergenic
1162488643 19:10977876-10977898 CCACGGTGCCACCTGCCTCACGG - Intronic
1163234965 19:16024752-16024774 CCCCCTTGCCACCTCACTCGGGG - Intergenic
1163415904 19:17186382-17186404 CCCCCGTGGGACCACCAGCAGGG + Intronic
1165825672 19:38704509-38704531 ACCCCGGGCCCCCACTCTCAGGG - Intronic
1166007061 19:39915227-39915249 CCCGCGGGCCTCCACCCGCACGG + Exonic
1167163842 19:47784716-47784738 CCCCTGTGCCTCCTCCCTCCAGG + Intergenic
1168563914 19:57406627-57406649 CACCACTGCCACCACCATCACGG - Intronic
1168691477 19:58380283-58380305 CGACAGTGCCTCCACCCTCAAGG + Intronic
927990570 2:27444070-27444092 TACCCGGGCCACCACCTTCAAGG - Intronic
932222578 2:70011101-70011123 CCCCCCACCCTCCACCCTCAAGG - Intergenic
934764033 2:96870317-96870339 CCCCCGCCCCACCTCCCTCCAGG - Intronic
940637883 2:156320325-156320347 CCCCCCGCCCCCCACCCTCAGGG - Intergenic
940910009 2:159202175-159202197 GCCCAGTGCCACCACACTGACGG - Intronic
941674026 2:168324826-168324848 CCTCGCTGCCTCCACCCTCAAGG + Intergenic
944146620 2:196513933-196513955 CCCCACTGCCACCAGCGTCATGG - Intronic
944732931 2:202534987-202535009 ACCCCCTGCCACCTCCCTCCCGG + Intronic
947853869 2:233310077-233310099 CCCCCTTTCCACCACTCTCCAGG + Intronic
948079212 2:235191685-235191707 CCCCCGTGCCTTCTCCCTCAGGG + Intergenic
948689808 2:239694724-239694746 GCCCCGTGCCACCCTCCTGAAGG - Intergenic
948711492 2:239828296-239828318 CCCCAGAGCCACCAGCCACATGG + Intergenic
948873750 2:240816947-240816969 CCCCAGTGCCCCCACCCCCAGGG - Intronic
948897916 2:240935739-240935761 TCCCCCTGCCCCCACCCCCACGG - Intronic
1170331828 20:15220951-15220973 CTCCCGTGCCACCACACGCCTGG - Intronic
1170596813 20:17811691-17811713 CACCAGTGCCACCACACTGAAGG - Intergenic
1173674203 20:44820041-44820063 CCCCCTTGGGACCACCCTCAGGG + Intergenic
1173811702 20:45959868-45959890 CCCCAGTGCCAGCACACACAAGG + Intronic
1175714810 20:61248193-61248215 ACCCTGTTCCCCCACCCTCAAGG + Intergenic
1176117587 20:63439817-63439839 CCCCCGTGTCACCATCCACACGG + Intronic
1176159399 20:63640875-63640897 CCCCCGTCGCCCCTCCCTCATGG + Exonic
1180957801 22:19748835-19748857 CCAGTGTCCCACCACCCTCAGGG + Intergenic
1181778909 22:25178846-25178868 CCCCCGTTGCCCCTCCCTCATGG + Intronic
1183490566 22:38113448-38113470 CCCCCAGGCCACTTCCCTCAGGG - Intronic
1183686462 22:39363811-39363833 CCCCCGAGCCACCCAGCTCAGGG + Intronic
1185032288 22:48450410-48450432 CCCACCTGCCACCAGCCCCAGGG - Intergenic
1185181599 22:49366606-49366628 CCACCGTGGCACCTGCCTCATGG - Intergenic
951624517 3:24645070-24645092 CCCACCTGCCTCCACCCTGAGGG - Intergenic
954467564 3:50665382-50665404 CCACCCTGCCCCCACCCCCAAGG + Intergenic
956483243 3:69693992-69694014 TCCCCATTCCACCACCCTTAGGG - Intergenic
957922042 3:86759050-86759072 CTCCCCTGCCACCTCCATCAGGG - Intergenic
961657755 3:128452713-128452735 CCCCCATCCCGCCACCCCCAGGG + Intergenic
964606862 3:158569855-158569877 ACCCCATGCCACCAGTCTCAGGG + Intergenic
965014525 3:163140086-163140108 CCCCATGGCCACCACACTCAAGG + Intergenic
965596853 3:170419028-170419050 TCCCCGTGCCTCGCCCCTCACGG - Exonic
966098636 3:176239066-176239088 CCCCCCTCCCCCCACCCTGATGG + Intergenic
966636046 3:182134949-182134971 CCCCAGGGCCACCACCACCACGG - Intergenic
966826162 3:183966769-183966791 CCCAGGCACCACCACCCTCAAGG + Intronic
967514161 3:190347180-190347202 CCCCATTGCCACCATCATCATGG - Intronic
967776666 3:193392632-193392654 GTCCCCTGCCACCAACCTCAGGG - Intergenic
967888032 3:194346344-194346366 CCCCAGTGATACCACCCACAAGG - Intronic
968563458 4:1296830-1296852 CTCCCGTGACACCATCCTCTGGG + Intronic
969085481 4:4653047-4653069 CCACCATTCCACCCCCCTCAGGG - Intergenic
969135473 4:5025326-5025348 CCCCCGTTCCACCTCCCCCCTGG - Intergenic
969463095 4:7339120-7339142 CCCTCCTGTCCCCACCCTCACGG - Intronic
973646195 4:52953525-52953547 TCCCCTTGACACCACCTTCAGGG - Intronic
974110117 4:57515349-57515371 CACTAGTGCCACCACCTTCATGG + Intergenic
976868947 4:89767577-89767599 CCTCCCTGCCACCTCACTCATGG + Intronic
981212427 4:142123983-142124005 CCCACCTGCCTCCATCCTCATGG - Intronic
983100099 4:163614935-163614957 TCCCCATGCCACCTTCCTCAGGG - Intronic
983768635 4:171519527-171519549 CCCCTGGGGCACCACCCTCCAGG + Intergenic
984866305 4:184283698-184283720 CTCCAGTGCCACCAGACTCAGGG + Intergenic
986690295 5:10308073-10308095 CCTCCCTGCCTCCTCCCTCAAGG - Intergenic
987306033 5:16638735-16638757 CCACCTTGGCTCCACCCTCAGGG + Intergenic
987447516 5:18038560-18038582 TCACCGTGCCACCATCCCCAAGG - Intergenic
992780675 5:80124310-80124332 TCCCCGTGCCAACAGTCTCAGGG + Intronic
993792284 5:92222883-92222905 CCCCCCTTCAGCCACCCTCATGG - Intergenic
995544663 5:113218076-113218098 CCCCCGTGCAACCATCCTTCTGG - Intronic
997431378 5:133843471-133843493 CCACAGTCCCACCACACTCAGGG + Intergenic
997827888 5:137123942-137123964 CCCCAATGCCAGCACCCTGAAGG + Intronic
1001922711 5:175612949-175612971 CTCCTGTGCTACCTCCCTCAAGG - Intergenic
1002436676 5:179235842-179235864 CAACAGTGCCCCCACCCTCAGGG + Intronic
1003175892 6:3751966-3751988 CCCCCGCGCCTCCTCCCTCGCGG + Exonic
1005295745 6:24425036-24425058 CCCCTGTGCCACCACACTGTGGG + Exonic
1005480728 6:26252939-26252961 CCCACATTCCTCCACCCTCATGG + Intergenic
1006514002 6:34536052-34536074 ACCCCTTGCCCCCAACCTCAGGG + Intergenic
1008665381 6:53710853-53710875 CCACCCTGCCATCATCCTCAGGG - Intergenic
1011324079 6:86129826-86129848 CCCCACTGCCACCACCATGAAGG + Intergenic
1011329326 6:86186426-86186448 CCCCACTGCCTGCACCCTCATGG + Intergenic
1014633139 6:123812043-123812065 CCCCACCGCCCCCACCCTCAAGG + Intronic
1018232409 6:161688246-161688268 CCCCAGTGCCAGGACCATCATGG + Intronic
1018867878 6:167759602-167759624 CCCCCGTTCCACCAGCATCAGGG - Intergenic
1019152725 6:170019587-170019609 CCCCTGTGCCCCCACGCCCAGGG + Intergenic
1019318856 7:405813-405835 CCCCCATGCCCCCATCCTCGGGG + Intergenic
1019694136 7:2435404-2435426 CTCCAGTGCCTTCACCCTCAAGG + Intergenic
1020508149 7:9019351-9019373 AGCCCATGCCATCACCCTCATGG + Intergenic
1022114320 7:27249116-27249138 CCTCCCTGCCACCACCCAAATGG - Intergenic
1023889355 7:44381485-44381507 CCCCCGAGTCACCAGCCACATGG + Exonic
1024893259 7:54227021-54227043 CTCCCCTGCCACCACCATTAGGG + Intergenic
1024900659 7:54315366-54315388 CTCCCCTGCCACCACCATTAGGG - Intergenic
1026512565 7:71039077-71039099 CTCCCTTGGCAACACCCTCATGG + Intergenic
1028871215 7:95772966-95772988 CCCCAGTGACACCCCCCTCTCGG + Intronic
1029189495 7:98761627-98761649 CCCCCGCTCCACCATCCTTAAGG - Intergenic
1029473399 7:100768534-100768556 CCCCAGGGCCACCATCCTCCTGG - Intronic
1035309108 7:157953492-157953514 CACCCGTGCCAGCAGCCTCATGG - Intronic
1035690177 8:1554780-1554802 CCCCGCGCCCACCACCCTCACGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038393063 8:27223206-27223228 CTCCTTTGCCAACACCCTCACGG - Intergenic
1041254175 8:55965181-55965203 CCCCCGAGGCACCACCCTTCTGG - Intronic
1044058721 8:87605699-87605721 TCCCCCTGCCACCACCCTCCAGG - Intronic
1045499137 8:102731767-102731789 CCCGCGTGCCAGCTCCCCCAAGG - Intergenic
1047894759 8:129354215-129354237 CCCCCATGCCACCACCTTCCAGG + Intergenic
1048611207 8:136025101-136025123 CCCCTCAGCCACTACCCTCATGG - Intergenic
1049462762 8:142737679-142737701 CCCACGAGCCACCTCCCCCAAGG - Intergenic
1049815559 8:144597561-144597583 GCCCCCTGCCCCCATCCTCAAGG - Intronic
1049850803 8:144829205-144829227 CCCCCTTGCCCCCAACCCCAAGG + Intronic
1052770034 9:32679155-32679177 CCCCCCTGCCACCACCACCCAGG - Intergenic
1052812783 9:33076359-33076381 CACCCGTGCCACCTCCCTCGAGG + Intronic
1052987944 9:34501764-34501786 CCCCCATGCCCCCACCCACCCGG - Intronic
1053013849 9:34650856-34650878 CCCCTTTGCCACCACCCCTAGGG + Exonic
1056579797 9:87882705-87882727 CCCCAGTCCCTCCACCCTCCTGG - Intergenic
1059557034 9:115291843-115291865 CCACCTTGCCACTACCCCCAAGG - Exonic
1060265397 9:122108982-122109004 CCCCAGCACCACCACCTTCAGGG + Intergenic
1061235956 9:129342748-129342770 TCCCAGTGCCACCCCCCTCCCGG - Intergenic
1061236254 9:129344244-129344266 TCCCGGTGCCACCCCCCTCCCGG - Intergenic
1061542868 9:131287686-131287708 CCCTCGTGCCACCCCCCATAGGG + Intergenic
1061719431 9:132542658-132542680 CCAGCGTGCAGCCACCCTCAGGG - Intronic
1061920774 9:133781224-133781246 CCCAGGTGCCAACACGCTCAAGG + Intronic
1190300302 X:49053559-49053581 CCCCGGTCCCCCCACCCTCTAGG + Intronic
1192145999 X:68683114-68683136 CCCCCTTGTCACTGCCCTCAAGG + Intronic
1196034576 X:111130267-111130289 CCCCCATCCCATCATCCTCACGG + Intronic
1200055911 X:153460814-153460836 TGGCCGTGCCACCACCATCACGG + Intronic