ID: 900321872

View in Genome Browser
Species Human (GRCh38)
Location 1:2088484-2088506
Sequence CTCGAGTCCTTGAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900321869_900321872 -1 Left 900321869 1:2088462-2088484 CCCTGGACATTTGCTGAACGTCC 0: 1
1: 0
2: 1
3: 3
4: 95
Right 900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 13
4: 104
900321867_900321872 11 Left 900321867 1:2088450-2088472 CCCAGCAGGGCTCCCTGGACATT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 13
4: 104
900321868_900321872 10 Left 900321868 1:2088451-2088473 CCAGCAGGGCTCCCTGGACATTT 0: 1
1: 0
2: 1
3: 21
4: 215
Right 900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 13
4: 104
900321870_900321872 -2 Left 900321870 1:2088463-2088485 CCTGGACATTTGCTGAACGTCCT 0: 1
1: 0
2: 1
3: 11
4: 89
Right 900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 13
4: 104
900321865_900321872 18 Left 900321865 1:2088443-2088465 CCTGGGACCCAGCAGGGCTCCCT 0: 1
1: 2
2: 1
3: 49
4: 464
Right 900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900321872 Original CRISPR CTCGAGTCCTTGAGTGAAGA CGG Intronic
900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG + Intronic
902178981 1:14673245-14673267 TTCCAGTCCTTGACTGAAGGTGG + Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
907393764 1:54175839-54175861 CTCGAGTCCTTGATATAAAATGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908722998 1:67146478-67146500 CCTGAGTCCTAGAGTGAAGGGGG - Intronic
912661252 1:111532827-111532849 CTCTAGTCCAAGGGTGAAGATGG + Intronic
914981228 1:152416058-152416080 CTCCAGTCCTGGGGTGAAGGTGG + Intergenic
921488512 1:215745178-215745200 CTTGAGTTTTGGAGTGAAGAAGG - Intronic
1066933329 10:41795275-41795297 CTTGAGTCCTTTGGTGAAAAAGG + Intergenic
1067211189 10:44261404-44261426 CTCCAGTGCTTCAGTGAAGAGGG - Intergenic
1068921397 10:62488497-62488519 CTCTAGTCTTTAAATGAAGAGGG + Intronic
1071458231 10:85867685-85867707 CTTGAGTCCATGAGTGATGCGGG + Intronic
1072095884 10:92179168-92179190 CTCCAATCCTTGAGAGAAGGGGG - Intronic
1074305744 10:112276576-112276598 CTCAAGTCCTTGGGTGACCATGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075698323 10:124451587-124451609 CTCCAGTCCTAAAGTGAAGACGG + Intergenic
1079427312 11:20356059-20356081 CTCCTGTCATTGTGTGAAGAAGG - Intergenic
1084012678 11:66361400-66361422 CTAGAGTCCTGGAGTGAGGTTGG - Intronic
1084682796 11:70676777-70676799 CTAGAGTCCTTGAAGGAATAAGG - Intronic
1086206249 11:84261443-84261465 ATTGAGTCCTGGAGTGATGATGG - Intronic
1087652969 11:100889797-100889819 CACGAGCCCATGAGTGAACAAGG - Intronic
1096559404 12:52424830-52424852 CTGGAGTCCTTGGGTGGGGAGGG + Intronic
1096575270 12:52548863-52548885 CTGGGTTCCCTGAGTGAAGAAGG + Intronic
1098046844 12:66409155-66409177 CTTTGGTCCTTGAGTGAACATGG + Intronic
1102813589 12:115844356-115844378 CTTGAGGCCTTGTGGGAAGAAGG - Intergenic
1107274499 13:38662913-38662935 CTCAAGTCCTTGAGTGATGGTGG - Intergenic
1115566658 14:34630257-34630279 CTCGAGTCCGTGAGCGAGGAAGG + Intergenic
1118634897 14:67739249-67739271 CTTGAGACCATGAGTGAAGCTGG + Intronic
1121838229 14:97110762-97110784 CTGGCGTCCTTAAGAGAAGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1124101400 15:26697530-26697552 CTCAAGTCCTCCAGTGAAGCAGG + Intronic
1129786643 15:78314259-78314281 GTCGGGTCCTGGAGTGGAGATGG + Intergenic
1131439092 15:92445077-92445099 CTCCATTCCTTGAGAGATGAGGG + Intronic
1133230836 16:4365770-4365792 CTCCAGTCCTGGAGTGACGCAGG - Intronic
1133931000 16:10232021-10232043 CTGCATTCCTTGAGTGATGAAGG + Intergenic
1134132267 16:11657791-11657813 CTGGAGTCCCTGAGTGAGAAAGG - Intergenic
1138276551 16:55739087-55739109 CTAGGCTCCTTGAGTGATGAGGG + Intergenic
1138282474 16:55782479-55782501 CTAGGCTCCTTGAGTGATGAGGG + Intergenic
1139204886 16:65018155-65018177 CTTGGGTTCTTGAGTGGAGAAGG - Intronic
1139386504 16:66575864-66575886 CTCAAGTCTTTGAGTGTTGATGG - Intronic
1139846963 16:69928122-69928144 CTCGAGTCTTGGAGTCAGGAGGG + Intronic
1140407304 16:74719297-74719319 CTGGGGTCCTTGAGTCAAAATGG + Intronic
1142626646 17:1196641-1196663 CTCGAGTCCCTGGGAGAAGACGG + Intronic
1151420661 17:73995059-73995081 CTGGAGTCCTTGAAAAAAGAGGG - Intergenic
1156507565 18:37607983-37608005 CTCAAGTCCTTGGGAGAGGAAGG + Intergenic
1156586891 18:38440892-38440914 TTCAAGTCATTGAGAGAAGAGGG - Intergenic
1160987793 19:1847718-1847740 CTCCAGTCGTTGAGTTAGGATGG - Intronic
1162864636 19:13535536-13535558 CTCAAGTCCCTGATAGAAGATGG + Intronic
1164364335 19:27558720-27558742 TTTGAGTCCTTGGGTGAAAAAGG + Intergenic
1166835328 19:45664190-45664212 CTCCTGTCCTGGAGTGGAGAGGG - Intergenic
1167461856 19:49629270-49629292 CTAGAATCATTGAGTTAAGAGGG + Intergenic
1168256019 19:55165804-55165826 CCCGAGTCCTTGAGGGAGGAAGG - Intronic
927855227 2:26523581-26523603 CCTGAGTCCTTCAGAGAAGAGGG + Intronic
930514411 2:52388256-52388278 CTCGAGTCAGTGAGTGCTGATGG - Intergenic
930702755 2:54475543-54475565 CCAGAGTCCTTGAGTGAGAATGG + Intronic
930791562 2:55336371-55336393 CTAGAGTCCCTGAGTGGAGTTGG - Intronic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
932792010 2:74662074-74662096 CTGGAGTCCCTGGGTGAGGAAGG + Intronic
934136027 2:88997346-88997368 CTCAGGTCCTGGAGTGAGGAGGG - Intergenic
934568360 2:95352918-95352940 CTCCAGTCCATGGCTGAAGAGGG + Intronic
936457805 2:112688734-112688756 CTCCTGCCCTGGAGTGAAGAGGG + Intergenic
936795175 2:116195637-116195659 CTTGGGTCCTTGAGTGAACATGG - Intergenic
937862183 2:126719914-126719936 GTGCAGTCCTTGAGTGAAGTAGG + Intergenic
943662438 2:190573560-190573582 CCTGAGTCCTAGAGTAAAGATGG + Intergenic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
948086025 2:235249052-235249074 CTCAAGTCCTTGATAGAAAATGG - Intergenic
1174296534 20:49549237-49549259 CTCAAGTCCTTGATTTAAAATGG + Intronic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1174896070 20:54451515-54451537 CTCAAGCCCTTGCGTGGAGAAGG - Intergenic
1175509854 20:59516589-59516611 CTGGAGTCCTTTACTGAGGAAGG + Intergenic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
952673100 3:35994469-35994491 CTCAGGGCCTTGAGTGAACATGG + Intergenic
957353382 3:79053613-79053635 CTAGCGTCCATGTGTGAAGAAGG - Intronic
958913829 3:100025545-100025567 CTCGAATCCCTGAGGTAAGATGG + Intronic
963654094 3:148023814-148023836 CTAGAGTGGTTGAATGAAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969258526 4:6019423-6019445 CTTGAGTGCCTGAGAGAAGATGG - Intergenic
969271232 4:6104788-6104810 CCTGAGTCCTGGAGTGAAGGGGG - Intronic
971899979 4:32646765-32646787 CTGGTGTCCATGTGTGAAGAAGG - Intergenic
972584671 4:40426475-40426497 CTCGAGTCCCTGAGAGAAAATGG + Intronic
981073448 4:140568726-140568748 CTCCAGTCTCTGAGTGAAGATGG - Exonic
982629196 4:157810188-157810210 ATCCACTCCTTGAGAGAAGAGGG - Intergenic
985849208 5:2376178-2376200 CTCGTGTCCTTGAGGGACCAGGG + Intergenic
990219063 5:53566635-53566657 CTCAAGTCCTTGATTTAAGATGG + Intronic
1000101766 5:158023500-158023522 TGCGAGTCCTTGGGGGAAGATGG + Intergenic
1001090330 5:168735383-168735405 CTAGAGTCCTGGAGTGATGTGGG + Intronic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1009249031 6:61275512-61275534 CTGGCGTCCATGTGTGAAGAAGG - Intergenic
1010316272 6:74454227-74454249 CCCGAGAGCTGGAGTGAAGAGGG - Intergenic
1010492775 6:76494720-76494742 CTGGCGTCCATGTGTGAAGAAGG + Intergenic
1016207398 6:141486217-141486239 CACGTGCCCTTGACTGAAGATGG + Intergenic
1020114909 7:5470835-5470857 CTCCAGGCCTTGGGTGAAGGAGG - Intronic
1020279682 7:6643936-6643958 CTCGTGTCCTTGGGTAAGGACGG + Exonic
1022147388 7:27558644-27558666 CTGGAGTGCTGGAGTGAATATGG - Intronic
1023025928 7:36049559-36049581 CTCCTGTGTTTGAGTGAAGAAGG + Intergenic
1033148762 7:138894560-138894582 ATCTAGTGCATGAGTGAAGAAGG - Intronic
1035131094 7:156654368-156654390 CTCAAGTCCCTGATAGAAGATGG - Intronic
1038516745 8:28193888-28193910 CTCCATTACTTAAGTGAAGAAGG + Intergenic
1038881877 8:31623576-31623598 CTCAAGTCCATGAGGGAAGTAGG - Intergenic
1038947245 8:32374883-32374905 CCCAAGTCCTTGAGTGAGGATGG + Intronic
1039586922 8:38714560-38714582 CTAGACCCCTAGAGTGAAGAAGG - Intergenic
1042596490 8:70453384-70453406 CTCCACTCCATGTGTGAAGAAGG - Intergenic
1043472457 8:80576512-80576534 TTCGACTCCTTGAATGAAAAAGG + Intergenic
1045381795 8:101634728-101634750 GTCATGTCCTTGAGTGAACAAGG - Intronic
1047159023 8:122355632-122355654 CTTGAGCCCTTGTGTAAAGATGG + Intergenic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1052853544 9:33392877-33392899 CTGGAGGACTTGTGTGAAGAAGG - Intronic
1058869830 9:109192084-109192106 CTAGAGCCCTTGAGGGAGGAAGG - Intronic
1060141023 9:121210221-121210243 CCTGAGTCCTAAAGTGAAGATGG - Intronic
1062309482 9:135928395-135928417 CCCCTGTCCTTGAGTGGAGATGG - Intergenic
1062512621 9:136915606-136915628 CTCGAGTCCCTGATGGAAGATGG - Intronic
1186341845 X:8653849-8653871 ATCCAGTGCATGAGTGAAGAAGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1198894875 X:141442637-141442659 CTAAAGCCCTTTAGTGAAGAGGG - Intergenic
1199331481 X:146565754-146565776 CTCAAGGCCCTGAGAGAAGAAGG - Intergenic