ID: 900322888

View in Genome Browser
Species Human (GRCh38)
Location 1:2093755-2093777
Sequence TACACAGCACGTCCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900322888_900322900 27 Left 900322888 1:2093755-2093777 CCTCACAGAGGACGTGCTGTGTA 0: 1
1: 0
2: 0
3: 17
4: 116
Right 900322900 1:2093805-2093827 GCCTGTGCTTGGAGCTGCATCGG 0: 1
1: 0
2: 0
3: 14
4: 274
900322888_900322902 28 Left 900322888 1:2093755-2093777 CCTCACAGAGGACGTGCTGTGTA 0: 1
1: 0
2: 0
3: 17
4: 116
Right 900322902 1:2093806-2093828 CCTGTGCTTGGAGCTGCATCGGG 0: 1
1: 0
2: 0
3: 20
4: 225
900322888_900322895 16 Left 900322888 1:2093755-2093777 CCTCACAGAGGACGTGCTGTGTA 0: 1
1: 0
2: 0
3: 17
4: 116
Right 900322895 1:2093794-2093816 CGGCCTGCCCCGCCTGTGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 205
900322888_900322890 -4 Left 900322888 1:2093755-2093777 CCTCACAGAGGACGTGCTGTGTA 0: 1
1: 0
2: 0
3: 17
4: 116
Right 900322890 1:2093774-2093796 TGTACGGTGCCTCCTCCCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900322888 Original CRISPR TACACAGCACGTCCTCTGTG AGG (reversed) Intronic
900196774 1:1380676-1380698 GACACAGCAGCTGCTCTGTGTGG + Intergenic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
902510293 1:16963258-16963280 TACCCATCACCTCCTCAGTGAGG - Intronic
906480306 1:46195016-46195038 TACATAGTTCGTGCTCTGTGAGG - Intronic
906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG + Intronic
907268228 1:53275592-53275614 CACAGAACACATCCTCTGTGAGG - Intronic
907682875 1:56580224-56580246 TACATAGGAAGTGCTCTGTGAGG + Intronic
907920192 1:58904308-58904330 AACACGGGACATCCTCTGTGTGG + Intergenic
908155872 1:61352546-61352568 TACCCAGCACATCCTCTACGAGG + Exonic
909020874 1:70429271-70429293 TACTCAGCCCTTCCTATGTGTGG - Intronic
911181531 1:94864917-94864939 TACACAGCACGTTCTGTGTTTGG + Intronic
915635946 1:157186619-157186641 TAGCCAGCACCTCCTCTGGGAGG + Intergenic
915648129 1:157288439-157288461 TAGCCAGCACCTCCTCTGGGAGG - Intergenic
915662541 1:157416067-157416089 TAGCCAGCACTTCCTCTGGGAGG + Intergenic
920413639 1:205782827-205782849 TGCACACCACATCCTCTGTGTGG - Intergenic
922469612 1:225867885-225867907 TACCCAGCAAGTCCCCTGAGAGG + Exonic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
1069716801 10:70526354-70526376 TACTCACCACGTCCACAGTGTGG + Intronic
1075879352 10:125837083-125837105 TAGACAGCACTTCCACTGTGTGG - Intronic
1078457126 11:11484015-11484037 GACACAGCACCTACTCTGTGCGG + Intronic
1093180128 12:15957539-15957561 TACACAGCACGTCTTTGGTTGGG - Intronic
1095788396 12:46136574-46136596 TACAGAGCACAGCCTCTGTGGGG - Intergenic
1099610217 12:84858075-84858097 TGCACAGCAGGCCCTCTGTTAGG + Intergenic
1101835757 12:108294086-108294108 CACATAGCAGGTACTCTGTGTGG - Intronic
1105014015 12:132775009-132775031 TACACAGCAGCTGCTCAGTGTGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1122612770 14:102997095-102997117 GACACAGCCCCTCCTGTGTGGGG - Intronic
1122895928 14:104756966-104756988 TACAGAGCAGGTCATCTGTGAGG - Intronic
1126706202 15:51407780-51407802 TAGCCAAAACGTCCTCTGTGTGG - Exonic
1128902411 15:71436590-71436612 TTCACAGCACCTCATCTGTAGGG + Intronic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130024645 15:80260738-80260760 GACACAGCATGGCCACTGTGGGG + Intergenic
1135920994 16:26648940-26648962 TAGATAGCACCTCCTCTGGGTGG - Intergenic
1136492133 16:30615598-30615620 TGCAGAGCTCGTCCCCTGTGTGG + Intronic
1138294869 16:55877624-55877646 TGCACAGGACCTACTCTGTGAGG + Intronic
1139812736 16:69636411-69636433 TACCCAGTACGGACTCTGTGTGG + Intronic
1144297830 17:13895972-13895994 TACATATCACTTCCTTTGTGTGG + Intergenic
1144667504 17:17112008-17112030 TACCCAACACCTGCTCTGTGGGG - Intronic
1144946267 17:18971140-18971162 TCCACGGCAGGTCCCCTGTGTGG - Exonic
1146006486 17:29163747-29163769 ACCACAGCAAGGCCTCTGTGGGG - Intronic
1146950297 17:36900696-36900718 TACACAGGAAGTACTCAGTGGGG - Intergenic
1147468449 17:40632528-40632550 AACACATTACGTCCTCTGTATGG - Intronic
1148831856 17:50438233-50438255 TACACATCACTTCATTTGTGTGG + Intronic
1153377817 18:4400575-4400597 TACACAGAATGTTCTTTGTGGGG + Intronic
1155336149 18:24767332-24767354 TAAACATCACCTTCTCTGTGAGG - Intergenic
1155586968 18:27377499-27377521 TACACAGCAAGTACTCAGTCCGG - Intergenic
1159516695 18:69468485-69468507 TATACACCAGGTCCTCTGTGAGG + Intronic
1160190605 18:76711440-76711462 CACACAGGACGTGCTCTGTGAGG + Intergenic
1160382091 18:78467735-78467757 TACACTGCATGTGCCCTGTGGGG - Intergenic
1165297442 19:34939000-34939022 TAAATGGCACGTCTTCTGTGGGG - Intronic
925073510 2:990245-990267 TACACAGCAAGGCCTCTCTGAGG - Intronic
927732545 2:25487357-25487379 TACACATCACGTCCTTTGCAAGG - Intronic
930217462 2:48711170-48711192 TAAATATCACGTCCTCAGTGAGG + Intronic
931492569 2:62764861-62764883 TAAAAAGCACCTCCTCTATGAGG - Intronic
935626344 2:105175128-105175150 TACTGAGCACCTACTCTGTGTGG - Intergenic
942634117 2:177983327-177983349 AACACAGCAGGTCCTCAATGGGG - Intronic
943653182 2:190478983-190479005 TACCCAGCCCTTCCTCTTTGGGG + Intronic
943707024 2:191046589-191046611 TACAAAGAAAGTCTTCTGTGGGG - Intronic
946332232 2:219016933-219016955 TACACACCAGGCCCTCTGTCTGG + Intronic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
946652365 2:221907402-221907424 GAAACAGCATGTCCTGTGTGGGG - Intergenic
947966179 2:234283283-234283305 TACACTGAATGTCTTCTGTGTGG - Intergenic
1168888185 20:1274998-1275020 TAAACATCACCTCTTCTGTGAGG + Intronic
1169471821 20:5892724-5892746 TACTCATCACGTCATCAGTGGGG + Intergenic
1170826363 20:19799539-19799561 TAGGAAGCAAGTCCTCTGTGTGG + Intergenic
1172262872 20:33583837-33583859 TACACAGCAAGTTCACAGTGTGG - Intronic
1175734066 20:61373138-61373160 AACTGGGCACGTCCTCTGTGTGG + Intronic
1176154435 20:63611175-63611197 CACACAGCACCGCCTCTGCGTGG + Intronic
1177827059 21:26096048-26096070 TATACAGCAAATGCTCTGTGTGG - Intronic
1179970562 21:44834945-44834967 GACCCAGCAGGTCCTCGGTGGGG + Intergenic
1180082056 21:45491439-45491461 TACACTCCACCTCCTCGGTGGGG + Intronic
1182793023 22:32968720-32968742 TGCACATCAGGTTCTCTGTGAGG + Intronic
1183618696 22:38960222-38960244 TACCCAGCACAGCCTCTGTCTGG + Intronic
1183623899 22:38990167-38990189 TACCCAGCACAGCCTCTGTCTGG + Intronic
950454805 3:13086311-13086333 GACACAGCACATGCTCAGTGAGG + Intergenic
950519211 3:13486505-13486527 CAAACATCACCTCCTCTGTGAGG - Intronic
951578840 3:24140777-24140799 TACACAGCCCGTTCTCTCTCTGG - Intronic
953482452 3:43263013-43263035 TTCACACCAGGTCCTCTGTAGGG + Intergenic
953669968 3:44954010-44954032 AACACAGCACATGCTCTGTAAGG + Intronic
954904397 3:54047560-54047582 TACACATCACTTCATTTGTGTGG + Intergenic
955410844 3:58654419-58654441 TGCACAGCAAGTCCAGTGTGCGG - Intronic
955529350 3:59857094-59857116 GACACAGCACTTCCTCTGAGGGG + Intronic
959008152 3:101043937-101043959 TACACATCACTTCATTTGTGTGG + Intergenic
960074685 3:113471368-113471390 TTCACATCATCTCCTCTGTGTGG - Intronic
960798596 3:121514627-121514649 TACCCAGCATGTTCTCTGTGAGG - Intronic
961967320 3:130919043-130919065 TACACTGCACCTCTTCTGCGTGG + Intronic
964530063 3:157657911-157657933 TACACATCACTTCATCTGAGTGG - Intronic
968800935 4:2742908-2742930 TACTCTGCACCTCCTCTGTGGGG + Intronic
969621976 4:8283263-8283285 TACACACCACTTCCTCTACGGGG - Intronic
971481568 4:27119286-27119308 TAAACATCACGTCCTCAGGGAGG + Intergenic
972688414 4:41373179-41373201 TACATAGCACTTCCTCAGAGAGG - Intronic
975440498 4:74404990-74405012 TACACAGTAAGTCCTCAATGTGG - Intergenic
979178698 4:117698122-117698144 TACACAGCAATCCCCCTGTGGGG + Intergenic
979604788 4:122626458-122626480 TCCACAGCACCTTTTCTGTGGGG + Intergenic
984087762 4:175333289-175333311 TAAACAGCATGACCTCAGTGTGG + Intergenic
985491929 5:185418-185440 CACACAGCACTTCCCCTGGGAGG + Exonic
986319275 5:6614735-6614757 CACACAGCATGTTCTCTGAGCGG + Intronic
988919218 5:35925306-35925328 TAGACATCACCTCCTCTGAGAGG - Intronic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
997358755 5:133281044-133281066 TACCCAGCACGTTCCATGTGTGG - Intronic
999610543 5:153364554-153364576 CAAACAGCACCTCCTCTGTGAGG - Intergenic
999683697 5:154083590-154083612 TACAAAGCACCTCCACTGTAAGG - Intronic
1002317099 5:178350364-178350386 TACACAGCAAGTTGGCTGTGTGG + Intronic
1005386909 6:25294104-25294126 TGCACAGGACGTCCTCTTAGAGG + Intronic
1005430526 6:25752070-25752092 TATACAGCACATGCTCTGTGGGG - Intergenic
1006248311 6:32759180-32759202 CACACAGCACGCCTGCTGTGAGG + Intronic
1006888381 6:37401155-37401177 TACACATCACTTCATTTGTGTGG + Intergenic
1007800594 6:44388848-44388870 TAAGCATCACATCCTCTGTGTGG + Intronic
1011190811 6:84726327-84726349 TGCACAGCTCACCCTCTGTGTGG - Intronic
1013073506 6:106750636-106750658 AACACATCAAGTCCTCCGTGTGG + Intergenic
1013590931 6:111619191-111619213 TAGAGGGCATGTCCTCTGTGGGG + Intergenic
1015225316 6:130850831-130850853 TACCCAGCACCTCTTGTGTGGGG + Intronic
1017161592 6:151370748-151370770 CAACCAGCACCTCCTCTGTGGGG - Intronic
1018321138 6:162610099-162610121 TACATAGCATGTACTCTGTCAGG + Intronic
1019195500 6:170280088-170280110 AACACAGCCCGCCCTCTTTGAGG + Intergenic
1019366676 7:636698-636720 TCTACAGCACAGCCTCTGTGAGG - Intronic
1022045041 7:26616102-26616124 TACAGAGCTCATGCTCTGTGAGG + Intergenic
1024228184 7:47344412-47344434 CACACTTCACGTTCTCTGTGGGG - Intronic
1030313980 7:108095503-108095525 GACACAGGATTTCCTCTGTGAGG - Intronic
1030536250 7:110770943-110770965 TACATAGCACTTGCTCTGTGGGG + Intronic
1031932649 7:127701858-127701880 TATACACCACTTCATCTGTGTGG + Intronic
1034482837 7:151336147-151336169 TACACACCACGTCGTTCGTGTGG - Intergenic
1035291822 7:157844185-157844207 TGCACACCACCTCCTGTGTGTGG - Intronic
1035740229 8:1922154-1922176 TACACAGGAAGCCCTCTGTGAGG + Intronic
1042119421 8:65468815-65468837 TACACATCACTTCGTTTGTGTGG + Intergenic
1042846937 8:73177704-73177726 CACCCAGCACGTGCTCAGTGAGG - Intergenic
1050167999 9:2786552-2786574 GACAGAGGATGTCCTCTGTGTGG + Intronic
1054873206 9:70068333-70068355 TATTGAGCACCTCCTCTGTGGGG + Intronic
1056757942 9:89393977-89393999 TACTGAGCACGTCCTGTGTTGGG - Intronic
1057217791 9:93239024-93239046 CACACAGCACGCACTCTTTGGGG - Intronic
1057526953 9:95811321-95811343 TTCACAGCATCTACTCTGTGTGG - Intergenic
1060247484 9:121958561-121958583 TATACACCATGACCTCTGTGAGG - Intronic
1195741670 X:108071126-108071148 TACAAAGCCCGTATTCTGTGTGG + Intronic