ID: 900324989

View in Genome Browser
Species Human (GRCh38)
Location 1:2104336-2104358
Sequence TAACCTTCCCTCAGCCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900324989_900324995 -9 Left 900324989 1:2104336-2104358 CCCCACGGGCTGAGGGAAGGTTA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 900324995 1:2104350-2104372 GGAAGGTTACGGCTGGTGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 120
900324989_900324998 24 Left 900324989 1:2104336-2104358 CCCCACGGGCTGAGGGAAGGTTA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 900324998 1:2104383-2104405 GTGCTTGCCCCAGAGCTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 224
900324989_900324997 23 Left 900324989 1:2104336-2104358 CCCCACGGGCTGAGGGAAGGTTA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 900324997 1:2104382-2104404 AGTGCTTGCCCCAGAGCTGCAGG 0: 1
1: 0
2: 1
3: 28
4: 238
900324989_900324999 25 Left 900324989 1:2104336-2104358 CCCCACGGGCTGAGGGAAGGTTA 0: 1
1: 0
2: 0
3: 8
4: 80
Right 900324999 1:2104384-2104406 TGCTTGCCCCAGAGCTGCAGGGG 0: 1
1: 0
2: 18
3: 44
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900324989 Original CRISPR TAACCTTCCCTCAGCCCGTG GGG (reversed) Intronic
900324989 1:2104336-2104358 TAACCTTCCCTCAGCCCGTGGGG - Intronic
903864730 1:26389797-26389819 CCTCCTTCCCTCAGCCTGTGGGG - Intergenic
911434108 1:97832725-97832747 AGACCTTCCCTCAACCCATGGGG - Intronic
915298766 1:154940334-154940356 TTACCTTCGCTCAGCCCCAGGGG - Intergenic
919626312 1:199913662-199913684 GAATCTTCCCTCAGCCCCTCAGG - Intergenic
920496779 1:206460512-206460534 GAAACTTTCCTCAGCCCCTGAGG + Intronic
922324123 1:224512730-224512752 TTACCTTCCTCCAGCCCCTGAGG + Intronic
1065140915 10:22717148-22717170 TGACCTCCCCTCAACCCCTGAGG - Intergenic
1067373626 10:45707509-45707531 TAACCTTCCTTAAGCTCATGTGG - Intergenic
1067380063 10:45764718-45764740 TAACCTTCCTTAAGCTCATGTGG + Intronic
1067881448 10:50049280-50049302 TAACCTTCCTTAAGCTCATGTGG - Intergenic
1068749544 10:60576071-60576093 TAAAATTCCCTCAGCTCTTGGGG + Intronic
1072632424 10:97155457-97155479 TAACCTTCCACCAGCCCTTGGGG - Intronic
1076856107 10:133116282-133116304 TAACAGTCCCTCGGCCTGTGGGG + Intronic
1076890896 10:133282838-133282860 GAACCATCCCTCAGCCTCTGTGG - Intronic
1089098262 11:115937865-115937887 TCACCTGCCCTCAGCCAGTCTGG - Intergenic
1089180948 11:116582479-116582501 CAACCTTCCCTGAGCCCAAGAGG + Intergenic
1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG + Intronic
1093115938 12:15211092-15211114 TATGCTTCCCTCTGCCCATGTGG - Intronic
1102124293 12:110468152-110468174 TCACCTTCCCGCTGCCCGCGGGG + Intronic
1102992706 12:117326655-117326677 TCAGCTTCCCTCATCCCTTGCGG - Intronic
1105622323 13:22080330-22080352 TCACCTTCCCTCTGCCTGGGTGG - Intergenic
1106850880 13:33789949-33789971 TACCCTAGCCTCAGCCTGTGTGG - Intergenic
1121052396 14:90828130-90828152 CAACCTGCCTTCAGCCCATGGGG + Intergenic
1121339009 14:93093990-93094012 TAAACTTCTCTCAGCTCCTGGGG + Intronic
1121645131 14:95513173-95513195 TCACCTTTCCTCAGCACGCGTGG + Intergenic
1126925845 15:53585431-53585453 GATCCCTCCCTCAGCACGTGGGG + Intronic
1128823183 15:70681055-70681077 TGCCCTTCCCTCAGCCTGTGAGG + Intronic
1133684121 16:8149598-8149620 TAAAGTTCCCTGTGCCCGTGAGG - Intergenic
1138446140 16:57065362-57065384 TGACCTTCCCTCATCCTGTGGGG + Intronic
1141010880 16:80397388-80397410 GAACCTGCCCTCAGCCAGAGAGG + Intergenic
1142693941 17:1623170-1623192 GCAGCTTCACTCAGCCCGTGGGG + Intronic
1146787223 17:35731317-35731339 CACCCTTCGCTCAGCCCTTGAGG + Intronic
1157860819 18:51138628-51138650 AAACCTTCCCTCTGCCCAGGTGG + Intergenic
1167135515 19:47613123-47613145 TAACCTTCCTTCAGGAGGTGGGG + Intronic
925489587 2:4376868-4376890 AAGCCTTCCCTCAGCCCCTACGG - Intergenic
934681218 2:96285272-96285294 TAGTCTTCCCGCTGCCCGTGGGG + Exonic
936816904 2:116471190-116471212 TAAGATTCCCTCAGCCCGGATGG + Intergenic
940019369 2:149140674-149140696 AAACCTTCTTTCAGCCAGTGTGG - Intronic
940433466 2:153621848-153621870 AGACCTTCCCTCAGCCAGAGGGG - Intergenic
941494349 2:166181563-166181585 TAGCCTTTCCTTAGCCCGAGGGG - Intergenic
943042202 2:182816764-182816786 TAACCTTACTTTAGCCCTTGAGG + Intergenic
1169790044 20:9400568-9400590 TAACGTTCCCTCATGCCCTGTGG + Intronic
1170905532 20:20512717-20512739 GAACCTTCCCTAACCCCATGTGG - Exonic
1175078517 20:56396991-56397013 TAACCTTCCAGCAACCCATGTGG + Intronic
1176058321 20:63160651-63160673 TATACTTCCCCTAGCCCGTGAGG - Intergenic
1178113870 21:29397315-29397337 TCTCCCTCCCTCAACCCGTGAGG - Intronic
1183991075 22:41597348-41597370 CCAGCTCCCCTCAGCCCGTGTGG - Intergenic
950109638 3:10410715-10410737 AAACCTTCCTGCAGCTCGTGTGG - Exonic
951899331 3:27641518-27641540 TAACTGTCCCCCAGCCTGTGTGG + Intergenic
952407739 3:33019729-33019751 AAAGCTTTCCTCAGCCCTTGAGG - Intronic
953883486 3:46703173-46703195 TCACCCTCCATCAGCCCGTGAGG + Intronic
959462489 3:106644045-106644067 CAACCTTCCCTCTGCCACTGTGG + Intergenic
969962840 4:10962998-10963020 TAACCTTACATCAGTCCTTGGGG - Intergenic
972192984 4:36616997-36617019 TAACCTTCCCTCAACATATGGGG + Intergenic
975545476 4:75556258-75556280 TCAGCTTCCATCAGCCTGTGTGG + Intronic
976314398 4:83643739-83643761 TAAGCAACCCTCAGCCAGTGAGG - Intergenic
976408745 4:84688442-84688464 TACCCTTGCCTCAGCCCACGGGG + Intronic
980121917 4:128736241-128736263 TAATCTTCCCTCAGCAATTGGGG - Intergenic
982037040 4:151355997-151356019 TACCATTCCCTCTGCCAGTGGGG + Intergenic
985246750 4:187986709-187986731 TCTCCTTCCCCCAGCCCGTAGGG - Intergenic
989582211 5:43043413-43043435 CAGACTTCCCTAAGCCCGTGGGG - Intergenic
995145980 5:108787326-108787348 CAAGCTGCCCTCAGCCCCTGCGG - Intronic
1001288964 5:170443047-170443069 TTCCCTTCCCTCATCCTGTGGGG + Intronic
1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG + Intergenic
1015338120 6:132065075-132065097 TAATCTTCCCTAAACCTGTGTGG + Intergenic
1018832165 6:167451466-167451488 TGATCTTCCCTCACCCTGTGAGG - Intergenic
1018930878 6:168239572-168239594 CATCCTGCCCTCGGCCCGTGTGG + Intergenic
1021269417 7:18566953-18566975 AAACCTTCCCTCAGGTCCTGAGG + Intronic
1023414844 7:39922319-39922341 TCACCTTAACTCAGACCGTGGGG + Intergenic
1024435851 7:49354049-49354071 TCAACTTCCATCAGCCAGTGAGG + Intergenic
1024608848 7:51045987-51046009 TAATCTTCCCATGGCCCGTGTGG + Intronic
1027223889 7:76232178-76232200 TAAGCTGCCCTCAGCCCAGGGGG + Intronic
1031994817 7:128222985-128223007 TAAGCCTCCATCAGCCCATGTGG - Intergenic
1034227214 7:149493507-149493529 TTTGCTTCCCTCAGCCCCTGGGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037625971 8:20607557-20607579 TATCCCTCCCCTAGCCCGTGGGG + Intergenic
1049100421 8:140575028-140575050 TAACCTGCCCTCAACACCTGCGG + Intronic
1049998028 9:1049736-1049758 TAACCTTCACCGAGCCCGTGTGG - Intergenic
1056604971 9:88078057-88078079 TAACTTTCCCTCTGCCCAGGTGG + Intergenic
1056913882 9:90728524-90728546 TAAGCTTCACTTGGCCCGTGTGG - Intergenic
1060990326 9:127845280-127845302 TCACCTTCCCACAGCACGTTGGG + Intronic
1185595542 X:1304474-1304496 GAATCTTCCCTCAGCCCCTCGGG + Intronic
1189263840 X:39698622-39698644 TAACCTTCACACAACCCATGGGG + Intergenic
1190298052 X:49040053-49040075 TCACCCACCCTCAGCCCTTGAGG - Intronic
1192321720 X:70095339-70095361 TAAGTTTCCCTCAGCCCTTGGGG + Intergenic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1199672505 X:150158943-150158965 TCAGCTTCCATCAGCCAGTGAGG + Intergenic
1201621504 Y:15964062-15964084 TAACCATCCCTTAGCACATGGGG + Intergenic